ID: 963610276

View in Genome Browser
Species Human (GRCh38)
Location 3:147458256-147458278
Sequence CAATTCCCTCTGATTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963610269_963610276 22 Left 963610269 3:147458211-147458233 CCCATCTTTTAAAATCCAACTCA 0: 1
1: 0
2: 7
3: 67
4: 463
Right 963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 238
963610268_963610276 26 Left 963610268 3:147458207-147458229 CCTACCCATCTTTTAAAATCCAA 0: 1
1: 0
2: 8
3: 60
4: 422
Right 963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 238
963610271_963610276 7 Left 963610271 3:147458226-147458248 CCAACTCAACTGCCAAGTGCCAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 238
963610270_963610276 21 Left 963610270 3:147458212-147458234 CCATCTTTTAAAATCCAACTCAA 0: 1
1: 0
2: 10
3: 67
4: 522
Right 963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 238
963610273_963610276 -5 Left 963610273 3:147458238-147458260 CCAAGTGCCAAAGGTAATCAATT 0: 1
1: 0
2: 0
3: 8
4: 135
Right 963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963610276 Original CRISPR CAATTCCCTCTGATTTCCCA GGG Intronic
901374784 1:8830076-8830098 CAGTCCCCTCTGATTACTCATGG + Intergenic
901888345 1:12240214-12240236 CAATTCCCTTTACTTTCCCAAGG + Intronic
902156987 1:14495692-14495714 CATTTCCTCCTGATTTCCCGAGG - Intergenic
903002603 1:20276898-20276920 CAATTTCCTCTGAGAGCCCAGGG + Intergenic
903015462 1:20358657-20358679 CCCTTCCCTCTCCTTTCCCAGGG - Intergenic
903172780 1:21564036-21564058 CAATGCCCACAGATTTCCCTGGG - Exonic
905294333 1:36944677-36944699 CCCTTCCCTGTGATCTCCCAAGG + Intronic
905924785 1:41741669-41741691 CCTATCCATCTGATTTCCCATGG + Intronic
906476558 1:46173183-46173205 GTATTCCCTCTGATTTCCTCAGG + Intronic
906535026 1:46546656-46546678 CAATTCCCTAGGCTTTCCCTGGG - Intronic
908746327 1:67380091-67380113 AAATTCCCTCTCATTTCCGTGGG - Exonic
912099715 1:106190460-106190482 CTCTTCCCTCTGCTTTCCAAGGG - Intergenic
914755284 1:150558767-150558789 CACTTATCTCTGAGTTCCCAGGG - Intronic
915419081 1:155765500-155765522 CAATTTCCTCTAAATCCCCAGGG + Exonic
915632857 1:157165288-157165310 CCCTTCCCTCTTGTTTCCCATGG + Intergenic
917662065 1:177186602-177186624 CAATTCCCTCTCACTTCCCAGGG - Intronic
918798826 1:188944022-188944044 CAATTAGCTCTGGTTTCTCATGG + Intergenic
919835232 1:201568810-201568832 CGACTCCCTCTTCTTTCCCAGGG + Intergenic
919964565 1:202509475-202509497 CTATTCCTTCTTACTTCCCAAGG + Intronic
921763741 1:218946329-218946351 CAATACCCTCTGCTTACCCTAGG - Intergenic
1064255212 10:13737676-13737698 CAATCCCATCTGAGTTCCCTGGG - Intronic
1064364735 10:14697332-14697354 CAGTTCCTTCAGATTTTCCATGG + Intronic
1065677035 10:28187422-28187444 CAATTACCTTTGATTGGCCAAGG + Intronic
1065723110 10:28644736-28644758 CAATTCCCTCTGCGTTCCCTCGG - Intergenic
1069270533 10:66521488-66521510 GAATGCCCAGTGATTTCCCATGG + Intronic
1070690450 10:78521108-78521130 CAAAGCCCTCTGATTTCCTCGGG - Intergenic
1071415427 10:85436907-85436929 CCATTCTTTGTGATTTCCCAGGG + Intergenic
1072204781 10:93193659-93193681 ATATTCCATCTAATTTCCCACGG + Intergenic
1075234418 10:120713656-120713678 CCATTCCCTCTGATTGTACAAGG - Intergenic
1077973572 11:7222338-7222360 CACTTACTTCTGATTTCCAATGG + Intergenic
1078046550 11:7918376-7918398 CAATTGCATCTGAATTCCAAAGG - Intergenic
1080021070 11:27560745-27560767 CCATTCTCTCTCATTCCCCAGGG - Intergenic
1080229223 11:29999846-29999868 CAATTCCATCTGATTTGCCTAGG + Intergenic
1080359868 11:31500346-31500368 GAATTACCTCTGATTTCTCCAGG - Intronic
1085632797 11:78133345-78133367 AACTTCCCTCTCATATCCCAGGG + Intronic
1085924665 11:81001836-81001858 CTATTCACTCTCATGTCCCAGGG - Intergenic
1088997871 11:115018915-115018937 CAATTCCCCATGGGTTCCCAAGG + Intergenic
1089531510 11:119132838-119132860 CAATCCCTCCTGATTTCTCATGG + Intronic
1090758194 11:129813636-129813658 CCATTCGCTCTGTTTTACCAGGG + Intergenic
1091197839 11:133747085-133747107 CATTTCCCTCTGAGTGCACAGGG - Intergenic
1091301551 11:134510996-134511018 CAATGCCCTCAGCTTTACCAAGG - Intergenic
1093890112 12:24509647-24509669 CACATCCATCTAATTTCCCATGG - Intergenic
1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG + Intergenic
1095864228 12:46954185-46954207 AAAATCCCTCTTATTACCCAGGG + Intergenic
1098705651 12:73685407-73685429 CTCTTCCCTCTGCTTTCCAATGG - Intergenic
1103897858 12:124285888-124285910 CAGTTCCCTCTGGTTCTCCACGG + Intronic
1104375971 12:128266260-128266282 CTTTTCCCTCTGATTTCTCCAGG - Intergenic
1104594067 12:130107992-130108014 CAAGTCTGTCTGATTTTCCATGG - Intergenic
1105914854 13:24904228-24904250 AAATTCCCACTGATTTCCTCAGG - Intronic
1106076238 13:26463879-26463901 CCATTCCCTGGGATTTCTCATGG + Intergenic
1107205609 13:37782726-37782748 CAATTACTTATGATTTTCCAGGG + Intronic
1110076026 13:71244328-71244350 CACTTCCCTTTGTTTTCCTACGG - Intergenic
1110668595 13:78148247-78148269 CAATTATCTCTTATTACCCATGG + Intergenic
1111019300 13:82425877-82425899 CAAATCCCACTCATTTCCAAAGG - Intergenic
1111316440 13:86567191-86567213 CACTTCCCCCTGCTTTCCCCAGG - Intergenic
1111423347 13:88047058-88047080 CAATTCTCTTTCATTTTCCATGG + Intergenic
1112253562 13:97806783-97806805 CAATTCCCTCTGTTCTGCCTAGG + Intergenic
1112314936 13:98352297-98352319 CATTTCCCTGTGATTTCCAGTGG - Intronic
1112881466 13:104110753-104110775 TAATTCCTTCTGATTTCCTCTGG + Intergenic
1115275979 14:31608868-31608890 CAATTCTATCTGATAACCCAGGG - Intronic
1117353294 14:54901800-54901822 GCATTCCCACTGATTTGCCAGGG - Intronic
1119380029 14:74222541-74222563 CATTTCCATCTGTTTTCTCAGGG + Intergenic
1120168205 14:81222061-81222083 CAAGTCCCTCAAAATTCCCAGGG - Intergenic
1120712718 14:87809514-87809536 CAATTCCCTCCAATTCCCCTTGG - Intergenic
1122074096 14:99224619-99224641 CTTTTCCCTCTGATTCCCCCAGG + Intronic
1124898397 15:33798948-33798970 CAATTCATTCTGATGTCCTAGGG + Intronic
1125503019 15:40251306-40251328 CAATGCCCTCGGCTTTCCTAGGG - Exonic
1126405357 15:48317494-48317516 CAATTCCCTGTCATGGCCCAAGG - Intergenic
1126882895 15:53118094-53118116 CAATTCCTCCTGGTTTCCCTGGG + Intergenic
1126946998 15:53832506-53832528 CTATTCCCCCTCATTTGCCAGGG - Intergenic
1128189108 15:65673521-65673543 CCATCCCCTCTTATTTCTCATGG - Intronic
1128375856 15:67075330-67075352 TAATTCACTCTGCCTTCCCATGG - Intronic
1128877220 15:71212270-71212292 AAATTCCATCTGAGTCCCCATGG - Intronic
1132393272 15:101454208-101454230 GAATTCCTTTTGATTTCCCTTGG - Intronic
1132404917 15:101536298-101536320 CCATGGCCTCTGCTTTCCCAGGG + Intergenic
1134350165 16:13430064-13430086 CTTTTCCCTCTGATTTCACATGG - Intergenic
1134415048 16:14035884-14035906 CCTTTCCCTCTGAGTCCCCAAGG + Intergenic
1134806616 16:17131440-17131462 CAACTCCATCTGCATTCCCACGG + Intronic
1135046933 16:19163607-19163629 CAATCCTCTCTGCTTTTCCATGG + Intronic
1135509015 16:23065662-23065684 CAAATCCCTTTGGTTTTCCATGG - Exonic
1135550796 16:23396774-23396796 CATTTCCCTTCTATTTCCCAGGG - Intronic
1137452181 16:48586695-48586717 CAAATCTTTGTGATTTCCCAGGG - Intronic
1137777880 16:51071664-51071686 CAATGTCCTCTGCTTTCCCGAGG + Intergenic
1137785509 16:51134597-51134619 CACTTCCCTCAGATGTCCCCAGG + Intergenic
1137908419 16:52350546-52350568 CAATTACCTCTCATTCCTCATGG - Intergenic
1138730559 16:59189424-59189446 CACTTGCATGTGATTTCCCAAGG + Intergenic
1139152533 16:64400231-64400253 AATTTCTTTCTGATTTCCCAAGG + Intergenic
1140862942 16:79035293-79035315 CTAATCCCTTTGATTTCCAATGG + Intronic
1142118803 16:88375820-88375842 TCGTTCCTTCTGATTTCCCAAGG - Intergenic
1203139944 16_KI270728v1_random:1756387-1756409 CAATTTCCTCTGGTATTCCAAGG - Intergenic
1143059349 17:4186961-4186983 CAGTTTCCTCTGTTTTTCCATGG + Intronic
1146552228 17:33791310-33791332 CAATTTGCTCATATTTCCCATGG - Intronic
1146763350 17:35496945-35496967 TAATTACCTGTGTTTTCCCAGGG + Intronic
1146983932 17:37194511-37194533 CCATGCCCTCTGATCTCTCAAGG + Intronic
1147157681 17:38552414-38552436 CCCTGACCTCTGATTTCCCATGG - Intronic
1147950482 17:44104966-44104988 CAATTCCCCCTGTTTTCAGAGGG + Intronic
1148717835 17:49728484-49728506 CCATTCCCTCTGCATTCCCCAGG - Intronic
1149638429 17:58187795-58187817 CAACACACTCTGGTTTCCCAGGG - Intergenic
1149822849 17:59796598-59796620 CAATTATCTCTGTTTTCCTAAGG + Intronic
1151447321 17:74175803-74175825 CAGTTCCTTCTGGCTTCCCATGG - Intergenic
1151813476 17:76459032-76459054 CAAGTCCCACAGTTTTCCCAGGG - Intronic
1152718362 17:81910784-81910806 CAATGCCCTCTGACTGGCCAGGG + Intronic
1152759444 17:82100328-82100350 CAACTCCGTCTGGATTCCCATGG + Intergenic
1157302121 18:46486583-46486605 CATTGCCTTCTGCTTTCCCATGG + Intronic
1158623630 18:59053031-59053053 CAATTTCCTTTGTCTTCCCATGG + Intergenic
1159221418 18:65469000-65469022 CAATCCCAGCTGAGTTCCCAGGG - Intergenic
1159613442 18:70551757-70551779 CATTTTCCTCTGCTTTCCCCTGG + Intergenic
1160046320 18:75390484-75390506 TAATGCCCTCTGATGCCCCATGG + Intergenic
1160501552 18:79403585-79403607 CAATTTCCTCTGAGTTGCCACGG - Intronic
1160758108 19:768544-768566 GAATTCTGTCTGATTTTCCAAGG - Intergenic
1161357539 19:3827371-3827393 CAGCTCCCTCTGATCTCCCCAGG + Intronic
1161513027 19:4682409-4682431 GAATTCCCTCATCTTTCCCAGGG + Intronic
1163497870 19:17657091-17657113 CAATTCCCTGTGGCTTCCAAGGG - Intronic
1164551339 19:29214940-29214962 CAATTCCCTCTGAGTTGGTAAGG + Intergenic
1165113680 19:33516162-33516184 ACATGCCCTTTGATTTCCCATGG + Intronic
1165521983 19:36321837-36321859 CAATTTGCCCTGATTTCTCATGG + Intergenic
1165574366 19:36801374-36801396 CAATTTGCCCTGATTTCTCATGG - Intergenic
1165633827 19:37323706-37323728 CACTTTCCCCTGATTTCTCAGGG - Intronic
1168279540 19:55297417-55297439 CAATTCCCTCAGCAGTCCCAGGG + Intronic
924979910 2:210195-210217 CACTTCTCTCTCATTTCACAAGG + Intergenic
925125293 2:1450388-1450410 CGAGTCACTCTGATTTCCCTGGG - Intronic
932166742 2:69514685-69514707 CAGTTCCCTGTGGTGTCCCAAGG - Exonic
932177898 2:69619415-69619437 AATTTCCCTCTTCTTTCCCAAGG + Intronic
934080932 2:88467329-88467351 CCTATCCCTCTGCTTTCCCAGGG - Intergenic
939650596 2:144757513-144757535 CAAGTGCCTCAGACTTCCCAAGG + Intergenic
941599182 2:167519214-167519236 CAATTCCAAGTGATTTCCAATGG - Intergenic
944957285 2:204826446-204826468 CATTGCCCTGTGATTTCCTAGGG + Intronic
945522703 2:210848139-210848161 AAATTCTCTCCGCTTTCCCAAGG - Intergenic
948667861 2:239547259-239547281 CAGATGCCACTGATTTCCCAGGG - Intergenic
1169277444 20:4243391-4243413 CAATTCCCTGTGATTTTCCGTGG + Intronic
1171147275 20:22795963-22795985 TAATTGCCTCAGACTTCCCAGGG + Intergenic
1171568302 20:26217599-26217621 CAGTTTCCTCTCACTTCCCAAGG - Intergenic
1173001081 20:39106213-39106235 CAATGCCCTCTTCTGTCCCAGGG - Intergenic
1174104950 20:48155376-48155398 CTGTTCCCTCTGACTTCCCAGGG - Intergenic
1174554588 20:51384689-51384711 CAATTCACTCTGATTTCCAGGGG - Intergenic
1174837104 20:53866900-53866922 CAATTCCCTCTGGTATTCCAAGG - Intergenic
1175088560 20:56482740-56482762 AAATTTTCTCTAATTTCCCAGGG - Intronic
1175449220 20:59048108-59048130 CACTTTCCTCTGATTTGCCCTGG + Intergenic
1175510905 20:59525590-59525612 CTTTTCTCTCTGTTTTCCCAAGG + Intergenic
1178171440 21:30044900-30044922 CAATTCCACCTGCTTTCTCAGGG + Intergenic
1183005840 22:34901243-34901265 CATTTCTCTCAAATTTCCCAAGG - Intergenic
1184874475 22:47264794-47264816 CCATTCACTCTGAATCCCCATGG + Intergenic
951428610 3:22579940-22579962 CACTTGCTTTTGATTTCCCAGGG - Intergenic
953821972 3:46214729-46214751 CATTACCCTCTGCTTGCCCAGGG - Intronic
954342593 3:49967580-49967602 CACTTCCCTTTGATTTCCAGGGG + Exonic
954865577 3:53726733-53726755 CAAATCCATCTGTTATCCCATGG - Intronic
955351378 3:58196022-58196044 CACTTCCCACTCATTTGCCAGGG + Intronic
956426857 3:69144908-69144930 CATTGCCCTCTGATTTCCAAAGG - Intergenic
956468111 3:69538782-69538804 CACTTCTCTCTGACTGCCCACGG + Intronic
956740527 3:72272214-72272236 CAATTCATTCTGATTTACCTAGG - Intergenic
957110548 3:75950734-75950756 CAGTTTCCTCTCACTTCCCAAGG + Intronic
957357591 3:79112559-79112581 CAAATACCTGTGATTTACCAAGG + Intronic
957792153 3:84955550-84955572 AAATTTCCTGTGATTTCACATGG - Intergenic
957877420 3:86165918-86165940 CAATTCACTCTGCTTTTACAAGG - Intergenic
958874610 3:99601777-99601799 CCAGTCTCTTTGATTTCCCAAGG - Intergenic
959476960 3:106822802-106822824 CAATTGCCTTTGGCTTCCCAAGG - Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
961706974 3:128794588-128794610 TAATTGCCTCTCATTTGCCAGGG - Intronic
962931055 3:140036426-140036448 CAATGCCCTCTGATTCTTCAGGG - Intronic
963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG + Intronic
964707390 3:159633605-159633627 TACTTCCCTCTGAATTCCCAGGG - Intronic
965476952 3:169167979-169168001 CTATTCCCTCTCATTGCTCATGG - Intronic
966023369 3:175243796-175243818 AATTTCCTTCAGATTTCCCAAGG + Intronic
970161397 4:13192981-13193003 CAACTTCCTCAGATTTCCCCAGG + Intergenic
971459889 4:26883467-26883489 CCAATCCCTCTGTTTTCCAAGGG - Intronic
977336610 4:95707565-95707587 CTTTTCCCTCTGTATTCCCAAGG - Intergenic
977356779 4:95955591-95955613 AAGTTCCCTCTGATTTCCGCAGG - Intergenic
978842807 4:113234290-113234312 AAATCCTCTCTGATTTCACAAGG + Intronic
979267451 4:118719874-118719896 ATATTCCCTCTGTTTTCCAAGGG + Intergenic
979282299 4:118881362-118881384 CACTTCCCTCTGGCTTCACATGG - Intronic
981856415 4:149298799-149298821 CAATCCCCTGTGTATTCCCAGGG - Intergenic
981899499 4:149846018-149846040 AAAGTCCCTCTGATTGGCCATGG - Intergenic
983421685 4:167526674-167526696 CTATTCTCTCTCATTTCCAAAGG + Intergenic
984581459 4:181515194-181515216 GAATTGCCTCTGCTTTCCCCCGG + Intergenic
987641736 5:20621090-20621112 TAAATCTCTCTGATTTCACATGG + Intergenic
988486543 5:31672434-31672456 TAGTTCCCTCTGATTCCCCCAGG + Intronic
988705635 5:33723687-33723709 CAAGTACCTCTGCTTGCCCAGGG - Intronic
989131018 5:38106417-38106439 GAATTCTCTCTGTTTTCCAAAGG - Intergenic
992014819 5:72565145-72565167 CATCTCCTTCTGATTTACCAGGG + Intergenic
992511239 5:77437669-77437691 TAATTCACACTGTTTTCCCAAGG - Intronic
992512451 5:77451632-77451654 CAATTCACACTTATTTACCAGGG + Intronic
992535800 5:77702021-77702043 CCTTTCCCTCTGAGTCCCCAAGG - Intronic
993401482 5:87458166-87458188 CTCTTCCCTCTGTCTTCCCATGG + Intergenic
995750727 5:115450826-115450848 AAATTCCCTCTATTTCCCCATGG - Intergenic
996721635 5:126636197-126636219 CAAAGCACTGTGATTTCCCATGG + Exonic
997001345 5:129765828-129765850 GTATTCCCTCTGCTTTCCTAGGG - Exonic
997632850 5:135382795-135382817 CATTTTCCTCTGCTCTCCCAAGG - Intronic
998639366 5:143992154-143992176 ATATTCCATCTGAGTTCCCATGG - Intergenic
1000157740 5:158568411-158568433 CAAGTCACTCTCATCTCCCAAGG + Intergenic
1000594956 5:163204341-163204363 CATTTTCCTGTGATTTTCCAAGG - Intergenic
1002435866 5:179230340-179230362 CAATGCCCTGTGAGTGCCCAGGG - Intronic
1002589451 5:180279408-180279430 CAATTTCCTCTTAGCTCCCAGGG + Intronic
1003221643 6:4165704-4165726 CAATCCCCTCTGGATACCCAGGG - Intergenic
1003481805 6:6541468-6541490 CAAGCCCCTCCGAATTCCCATGG - Intergenic
1003673516 6:8181608-8181630 CAAATTGCTCTGATGTCCCATGG + Intergenic
1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG + Intergenic
1005194452 6:23266697-23266719 CCTTTCCCTCAGATATCCCATGG - Intergenic
1007481826 6:42155320-42155342 CAATTCCTTCTGTCTTCCCAAGG - Intergenic
1008473299 6:51908784-51908806 CCATTCCCCCTCATTTCCCCAGG + Intronic
1009472819 6:64049038-64049060 GATTTCTCTCTGAATTCCCATGG + Intronic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1010555095 6:77269091-77269113 AAATTCCCTTCTATTTCCCAAGG + Intergenic
1012104480 6:95137963-95137985 CTATTCCCTATATTTTCCCAGGG - Intergenic
1012210589 6:96513435-96513457 CAATTCCAGTTGATTTCACAGGG - Intergenic
1013265394 6:108492136-108492158 CACTTAGCTCTGATTTCCAAAGG + Intronic
1015462967 6:133514336-133514358 AAATTAACTCAGATTTCCCAAGG - Intronic
1015552166 6:134423054-134423076 CACTTCCATCTGAGTTCCCTAGG - Intergenic
1019120535 6:169800519-169800541 CATTTCCCTCTGATCTTTCAGGG - Intergenic
1019952028 7:4381257-4381279 CTATTACCTCTAGTTTCCCAAGG + Intergenic
1020777242 7:12470469-12470491 CAATTCCCTCCTATTCTCCAAGG - Intergenic
1023328924 7:39092037-39092059 CGATTGCCTCTGCATTCCCAGGG - Intronic
1023712407 7:43009012-43009034 TAATTCTCCCTGATTTCTCATGG + Intergenic
1024173026 7:46810051-46810073 CAATTCACCCTGATTGCCCCAGG + Intergenic
1025041334 7:55648589-55648611 CAATTCTCTCTGCTCTCCTAGGG - Intergenic
1025554196 7:62283588-62283610 CAATTCCCCCTGATTTAGGAAGG - Intergenic
1025560585 7:62369686-62369708 CAATTCCCCCTGATTTAGGAAGG + Intergenic
1032265503 7:130367549-130367571 CAACTCCCTCTGATTTGAAACGG - Exonic
1032514862 7:132499385-132499407 AACTTCCCTGGGATTTCCCATGG - Intronic
1032924547 7:136588660-136588682 CAATACCCTATTTTTTCCCATGG + Intergenic
1033280044 7:139999635-139999657 CCATTCACTCTGATTCTCCAGGG - Intronic
1033995152 7:147336884-147336906 AAATTCCCTCTCAATTCCAAAGG + Intronic
1034075498 7:148227234-148227256 CAATTGCCTCTACTTCCCCAAGG + Intronic
1034254980 7:149719987-149720009 CAGTTCCCTCTTCTTTCCCAGGG + Exonic
1035861056 8:3028056-3028078 CTTGTCTCTCTGATTTCCCAGGG - Intronic
1036410202 8:8492916-8492938 CTACTCCCTCTCCTTTCCCATGG - Intergenic
1037106164 8:15111218-15111240 CAATTCGCGCTGATTTCCTAGGG + Intronic
1037804251 8:22050350-22050372 AAAATCCCTCTGATTTCCGCAGG + Intronic
1038966289 8:32576506-32576528 CAATTCCCTATAATTTACCCAGG + Intronic
1039619735 8:38985553-38985575 CAGTGCCCTCTGATTTCACTAGG - Intronic
1041604597 8:59765981-59766003 CATTTCCCTATGAATTCCAAGGG + Intergenic
1042181766 8:66096185-66096207 CATCTCCCTATGATTTCACATGG + Intronic
1043934129 8:86123737-86123759 TAATTTCCTCTAATTTACCATGG - Intronic
1048849818 8:138634357-138634379 CAGTCCCCTGGGATTTCCCATGG - Intronic
1049979738 9:893023-893045 CTGTTTCCTCTGACTTCCCATGG + Intronic
1050034315 9:1419091-1419113 CAAGTCCTTCTGGCTTCCCATGG + Intergenic
1051177742 9:14378153-14378175 CAGTTTCCTCTGCTTTCCAAAGG + Intronic
1051357483 9:16253210-16253232 GAATTCCCACTGATTTACCAGGG - Intronic
1051393086 9:16587828-16587850 CAAGTACCACTCATTTCCCAGGG + Intronic
1053264561 9:36701241-36701263 CCCTTCCCTCTAATTTTCCATGG - Intergenic
1053860582 9:42382880-42382902 CTATTGCCTCTGAATTACCAGGG - Intergenic
1054728210 9:68674192-68674214 CAATTCCATCTTCTTTCCCCTGG + Intergenic
1057374073 9:94502791-94502813 CCATTTCCTCAGATTTCTCATGG - Intergenic
1057491735 9:95525542-95525564 CACTTCCCACTGAGCTCCCACGG - Intergenic
1057723553 9:97552911-97552933 CATTTTTCTCTCATTTCCCAAGG + Intronic
1061003952 9:127917813-127917835 CAGTTGCCTCTGAGATCCCAAGG - Intergenic
1061072796 9:128322125-128322147 CACTTTCCTCTGTTTTCCGAGGG - Intronic
1061609346 9:131736154-131736176 CAAATCCCTCTGAGCTCCTAGGG + Intronic
1188122816 X:26330554-26330576 CTATTCCCTCTGCTATCCCATGG - Intergenic
1193915531 X:87357726-87357748 CTTTTCCCTCTGCTTTCCAAAGG - Intergenic
1194659790 X:96617991-96618013 TTATTCCCCCTGCTTTCCCAAGG + Intergenic
1198149972 X:133898640-133898662 CATTACCCTTGGATTTCCCAAGG - Intronic
1198798484 X:140425125-140425147 CTCTTCCCTTTGTTTTCCCAGGG + Intergenic
1199204394 X:145131379-145131401 CAACTGCCTCTGATTTACAAAGG + Intergenic
1199824354 X:151483753-151483775 AAATTCCCTCAGATGTCCTATGG + Intergenic
1201567479 Y:15382159-15382181 CAATTCCATCTGATAGCACAAGG + Intergenic
1201700395 Y:16875010-16875032 CAATTCATTTTGATTTCTCAAGG - Intergenic