ID: 963612816

View in Genome Browser
Species Human (GRCh38)
Location 3:147493598-147493620
Sequence CTAATATTATTCAGAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 512}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963612816_963612819 21 Left 963612816 3:147493598-147493620 CCCTTTTCTCTGAATAATATTAG 0: 1
1: 0
2: 4
3: 52
4: 512
Right 963612819 3:147493642-147493664 GATTTCCTCTAAAATATCAGTGG 0: 2
1: 0
2: 3
3: 12
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963612816 Original CRISPR CTAATATTATTCAGAGAAAA GGG (reversed) Intronic
900388746 1:2423936-2423958 ATAAAATTATTCAGAGAAGAAGG - Intergenic
900716490 1:4148383-4148405 CTAATATCAAGCAGAGAGAAGGG - Intergenic
901758694 1:11456775-11456797 CTGGTATTAGTCTGAGAAAATGG - Intergenic
903865064 1:26391973-26391995 CTATTCTTATTCAAAGCAAAAGG - Intergenic
903871474 1:26438113-26438135 CTCATATTCTTCAGGGATAAAGG - Intronic
907360710 1:53912236-53912258 CTACTATTATTTAGTGAAAATGG - Intergenic
907845032 1:58197352-58197374 CTAATACCATAAAGAGAAAATGG - Intronic
907899879 1:58728467-58728489 CAAATATGATGCAGAGAATATGG + Intergenic
908152149 1:61313123-61313145 CAAATTGTATTCAGAGAGAATGG + Intronic
908336765 1:63133649-63133671 CTCATATAAGTCAGAAAAAAGGG + Intergenic
908602920 1:65760886-65760908 ATTATATTTTTCATAGAAAAAGG + Intergenic
909426394 1:75530181-75530203 TTATTATTATTAACAGAAAAGGG + Intronic
909692587 1:78425625-78425647 CTAATATATTCCAGAGAAAGGGG + Intronic
909891905 1:81017767-81017789 GTTATTTTATTCAGAAAAAAGGG - Intergenic
910204602 1:84735723-84735745 CTCAGATTACTCAGAGTAAATGG + Intergenic
910675348 1:89810530-89810552 CTAACACTGTTCAGAGAGAATGG - Intronic
910810655 1:91232324-91232346 CTCATATTCCTCAGATAAAAGGG - Intergenic
911725984 1:101240906-101240928 CTAATATCATTTAGATAAAGTGG - Exonic
911940089 1:104034978-104035000 CTAATAGTCTTAAGAGAAATAGG + Intergenic
912285771 1:108366794-108366816 CTAATTTCATTTACAGAAAATGG + Intergenic
913494393 1:119415023-119415045 TCACTATTATTCTGAGAAAAGGG + Exonic
913602866 1:120438781-120438803 CAAATATTTATCAGAGAACAAGG + Intergenic
913603614 1:120445134-120445156 CAAATATTTATCAGAGAACAAGG + Intergenic
914277239 1:146136196-146136218 CAAATATTTATCAGAGAAGAAGG - Intronic
914364041 1:146962398-146962420 CAAATATTTATCAGAGAACAAGG + Intronic
914487640 1:148124742-148124764 CAAATATTTATCAGAGAACAAGG - Intronic
914538286 1:148587144-148587166 CAAATATTTATCAGAGAAGAAGG - Intronic
914587988 1:149079896-149079918 CAAATATTTATCAGAGAACAAGG - Intronic
914764361 1:150625013-150625035 TGAACATTATTCACAGAAAATGG - Intronic
916819244 1:168382026-168382048 CTAAAATGATTATGAGAAAATGG + Intergenic
918208543 1:182330668-182330690 CTAATGTTACTCAGAAAATAAGG - Intergenic
918473479 1:184898980-184899002 CTGATATAATCCATAGAAAAAGG - Intronic
918504663 1:185239037-185239059 CTACTATTTTTAAGATAAAAGGG - Intronic
918709358 1:187707337-187707359 CTAAGAGTTTTCAGAGAAAAGGG + Intergenic
918911429 1:190576292-190576314 CTAATATTAGTTTCAGAAAAGGG + Intergenic
919190815 1:194216189-194216211 AGAAAATTATTCAGATAAAATGG - Intergenic
919270151 1:195331200-195331222 CTAATGTTATTCAGTAAAGAAGG + Intergenic
919399502 1:197094135-197094157 CAATTATCATTCAGAGAAAATGG - Exonic
919426215 1:197434741-197434763 CAAATATTATTCAGAAGCAATGG + Exonic
919577219 1:199325811-199325833 TTAATATTTATCAGAGAAATTGG - Intergenic
920240873 1:204549053-204549075 TTAATATGATGCTGAGAAAAAGG - Intronic
920268485 1:204744885-204744907 ATATTATAATTAAGAGAAAATGG + Intergenic
921253767 1:213321259-213321281 CTCAGATGATTCAGAGCAAAAGG - Intergenic
921401620 1:214729968-214729990 CTAATATTATGCAATGAGAAGGG - Intergenic
921593849 1:217033746-217033768 CTATTATTATTCACAGCAGAGGG - Intronic
924109845 1:240688011-240688033 CTACTGTCCTTCAGAGAAAAAGG - Intergenic
924207515 1:241728401-241728423 ATATTATTATTTACAGAAAAGGG + Intronic
1063003997 10:1951697-1951719 CAAAACTTATTCAGAGAAAAAGG - Intergenic
1063203769 10:3810926-3810948 TTAATATTAATTAGTGAAAACGG - Intergenic
1063640476 10:7825115-7825137 CTAAAATTATGCAGGAAAAAAGG - Intronic
1063802685 10:9598318-9598340 CTAATATAATAAGGAGAAAAGGG + Intergenic
1064685366 10:17855805-17855827 CCAAGGTTATTGAGAGAAAACGG - Intronic
1064843792 10:19627991-19628013 CAAACATTATTTACAGAAAAAGG + Intronic
1067824075 10:49557140-49557162 CAAATATTAGGGAGAGAAAAAGG - Intergenic
1068774770 10:60857708-60857730 CTATTATTATTCAATGAGAAGGG + Intergenic
1069277890 10:66615441-66615463 CAAATATTTTTCAAAGAAGAAGG + Intronic
1070063537 10:73010332-73010354 CTAATATAATTCTGAAAATATGG + Intronic
1070109662 10:73472695-73472717 CTTTTATTTTTCAGAAAAAATGG - Intronic
1070154653 10:73825952-73825974 CTAAGATTTGTCAGACAAAAAGG - Intronic
1070518868 10:77234237-77234259 ATAATATTTTTCTGAGAAAGGGG + Intronic
1071368807 10:84929326-84929348 ATAATAAAATTGAGAGAAAAAGG + Intergenic
1071443378 10:85724183-85724205 CTGATATTATTCAGAGAAATTGG + Intronic
1071808948 10:89156906-89156928 CTCTTATTTTTCTGAGAAAAGGG - Intergenic
1071929225 10:90447396-90447418 TTAAAATTATCCAGAGAATAAGG - Intergenic
1072904651 10:99441616-99441638 CCAATGTTTTTAAGAGAAAATGG + Intergenic
1073845850 10:107553517-107553539 CTAATAGTATTCAGAGGTGAGGG + Intergenic
1074024338 10:109618520-109618542 CTGGTATTATTCAGAGGCAAAGG - Intergenic
1074026265 10:109638790-109638812 CTAATTTTTTTAAAAGAAAAAGG + Intergenic
1075553861 10:123414690-123414712 ATAATTTTATTCATAGCAAAAGG - Intergenic
1075831594 10:125416650-125416672 CTAAGAAAATTCAGAGGAAAAGG + Intergenic
1076226510 10:128780746-128780768 TTAATATTAATCAGAGAAACTGG - Intergenic
1077382846 11:2253337-2253359 CAAATATCTTTCAGAAAAAAAGG + Intergenic
1078564932 11:12406256-12406278 CTGAGATTTCTCAGAGAAAATGG - Intronic
1078858262 11:15224336-15224358 CTAATGTTATTGGTAGAAAAAGG + Intronic
1079658578 11:23012937-23012959 CTTCTTTTATTCAGAGCAAAAGG + Intergenic
1079755559 11:24255739-24255761 ATAATTTTATTCAGAAAACATGG + Intergenic
1079851129 11:25536097-25536119 CTAATATTAATCAAAGAATAAGG + Intergenic
1080087430 11:28301290-28301312 CTGAAATTAGCCAGAGAAAAGGG - Intronic
1080145869 11:28983291-28983313 ATAATATAATGCAGAAAAAAAGG - Intergenic
1081150707 11:39627317-39627339 CTAAAAAGAGTCAGAGAAAATGG - Intergenic
1081357692 11:42133056-42133078 CTAAAAAGAATCAGAGAAAAAGG + Intergenic
1081631894 11:44695035-44695057 TTAATAGAATTCAGAGACAAAGG - Intergenic
1082734723 11:56843696-56843718 CTAATTTTATTTAATGAAAATGG + Intergenic
1083160998 11:60854082-60854104 CTAAGATCACACAGAGAAAAAGG + Intronic
1083834583 11:65257448-65257470 TTAATATTATTAAGAGAATTTGG + Intergenic
1085713078 11:78847740-78847762 ATAATATAATTCAGAGGAAGGGG + Intronic
1086037527 11:82434932-82434954 CTAATATACTTCATATAAAATGG - Intergenic
1086992208 11:93315806-93315828 CTAATATTTTTCAGAATGAAAGG - Intergenic
1087306337 11:96493369-96493391 CTAACATTCTTCAGATAGAAGGG - Intronic
1087896524 11:103592545-103592567 CTCATATTATTCCCAGAAAAAGG - Intergenic
1088166665 11:106946236-106946258 CTAATTCTACTAAGAGAAAAAGG + Intronic
1089128883 11:116196538-116196560 CTAGAAAGATTCAGAGAAAATGG + Intergenic
1089907718 11:122060525-122060547 CTAAAATTAGTCAGAAAAGAGGG + Intergenic
1091202171 11:133789726-133789748 CAAATATAATTAAGAGGAAATGG + Intergenic
1092329464 12:7569715-7569737 GAAATACTATTCAGAGAAAAGGG - Intergenic
1092658124 12:10709322-10709344 CTAATATTCTGCAGTGAAAAAGG + Intronic
1093985346 12:25525204-25525226 CTAATATTATACCGAGAGAAAGG + Intronic
1094037814 12:26089373-26089395 CTAATATAATTCAGGGACAAAGG - Intergenic
1094088184 12:26617501-26617523 CTAATGTTACACAAAGAAAAAGG + Intronic
1094286528 12:28800533-28800555 AAAATATAATTCTGAGAAAAAGG + Intergenic
1096882563 12:54684761-54684783 CTGATATTGTTCAGGGACAATGG + Intergenic
1097851240 12:64412368-64412390 CTGTTATTATTTAAAGAAAATGG + Intronic
1098403506 12:70099163-70099185 CTAATATAATGCAATGAAAAAGG - Intergenic
1099009363 12:77273484-77273506 TTATAATAATTCAGAGAAAAGGG + Intergenic
1099465155 12:82975804-82975826 AAAATAGTATTCAGAGAAACAGG - Intronic
1099597961 12:84692772-84692794 GAAATATAAATCAGAGAAAAAGG - Intergenic
1099623168 12:85030427-85030449 CTAATATTATTCTGAGAAAGGGG - Intronic
1099738168 12:86597373-86597395 ATAAAATTAATCAGGGAAAAAGG + Intronic
1100026857 12:90140800-90140822 CTGATATTGTTTACAGAAAAAGG - Intergenic
1100094548 12:91016234-91016256 CTATAATTATTTTGAGAAAAAGG + Intergenic
1100318986 12:93472287-93472309 CTACTATTATTGAAAGTAAAGGG + Intronic
1100471255 12:94895238-94895260 CAAATATTATACATAAAAAAAGG - Intergenic
1101108763 12:101465294-101465316 CACATAATATTCAGTGAAAAAGG - Intergenic
1101727139 12:107397210-107397232 CTAATATAAATCAGTGCAAACGG - Intronic
1103216634 12:119206741-119206763 CAAATATTCTTCATAGAGAATGG + Intronic
1104493166 12:129212265-129212287 CGTATGCTATTCAGAGAAAAAGG - Intronic
1105254369 13:18732067-18732089 CTAAAATTATTCTGAGAACCAGG - Intergenic
1105464733 13:20628058-20628080 GAAATATTATTAAGTGAAAAAGG + Intronic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1106745307 13:32698137-32698159 TTAATAATATTGTGAGAAAAAGG + Intronic
1107290519 13:38847874-38847896 TTAATATTTTTCAGACAAAGGGG - Intronic
1109019719 13:57073608-57073630 ATATTATTAATCAGAGAAAAGGG - Intergenic
1109512205 13:63392599-63392621 ATAATTTTATTGAGATAAAATGG - Intergenic
1109777621 13:67062825-67062847 CTAATATGTTTCAGAAAAATAGG + Intronic
1109853517 13:68100127-68100149 AGAAAATTAATCAGAGAAAAAGG - Intergenic
1110273561 13:73617708-73617730 CTATTATTATTCAAAGATATTGG - Intergenic
1111159143 13:84370651-84370673 CTAAAATTATTAAGAAAAAGAGG - Intergenic
1112679815 13:101750839-101750861 GGAATATTATTCAGTGATAAAGG + Intronic
1112831188 13:103453654-103453676 CTTATATTATTTAGAGGGAAAGG + Intergenic
1112987005 13:105463205-105463227 CTATCATTATTTACAGAAAAAGG - Intergenic
1113209575 13:107959830-107959852 CTCATATTGTTGAGACAAAAGGG + Intergenic
1114949130 14:27725106-27725128 ACTATATTATTCAGACAAAATGG + Intergenic
1115030950 14:28793434-28793456 CAAATATGATTCAGAGACGAGGG + Intronic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115358854 14:32478891-32478913 CTAATTTTATTCTGAGTCAAAGG - Intronic
1115662438 14:35510626-35510648 CTAATATTCTACAGAAAGAAAGG + Intergenic
1116055875 14:39863221-39863243 GTAATACTATTCAGCAAAAAGGG - Intergenic
1116416170 14:44680186-44680208 CAAATATTTTTAAAAGAAAAGGG + Intergenic
1116604754 14:46976047-46976069 GGAATAATTTTCAGAGAAAATGG + Intronic
1116606251 14:46999734-46999756 CAAAGATAATCCAGAGAAAAGGG - Intronic
1119226478 14:72948192-72948214 TTAATTTTTTTCAGAGAAAGGGG + Intronic
1119588987 14:75867376-75867398 CTATTATTATTAAAACAAAAAGG - Intronic
1119846923 14:77837472-77837494 GTAACCTTATTCAGAAAAAAGGG - Intronic
1120246137 14:82009281-82009303 ATAATATTATAATGAGAAAAAGG - Intergenic
1120299801 14:82692078-82692100 TGAACATTATTCACAGAAAATGG - Intergenic
1120355858 14:83432740-83432762 CTAATAGTATACAGAGAAACTGG - Intergenic
1120770708 14:88376722-88376744 TTAATATTCTTCAGAGATATTGG + Intergenic
1121283019 14:92713087-92713109 CTGAAATAATGCAGAGAAAACGG + Intronic
1123193524 14:106593993-106594015 CTTAAATTTTTCTGAGAAAATGG - Intergenic
1123202157 14:106676333-106676355 CTTAAATTTTTCTGAGAAAATGG - Intergenic
1202836429 14_GL000009v2_random:80511-80533 CTAATTCTGTGCAGAGAAAAAGG + Intergenic
1125081170 15:35675275-35675297 CTAAAAGGATTCAGGGAAAAAGG + Intergenic
1125301654 15:38260738-38260760 CTAATATTGTTCTGAGAAAGGGG + Intronic
1126946212 15:53823315-53823337 CAAATATTTTTAAAAGAAAAGGG - Intergenic
1128830040 15:70760426-70760448 ATAATATTATTCAAATGAAAAGG + Intronic
1129645542 15:77427741-77427763 TGAATATTATTCAGAAAATAAGG - Intronic
1130414758 15:83682489-83682511 CTAACATATCTCAGAGAAAAAGG - Intronic
1130755268 15:86756272-86756294 CTGAAATTTTTCTGAGAAAATGG - Intronic
1131328530 15:91472562-91472584 CAAATGTCCTTCAGAGAAAAGGG - Intergenic
1131452287 15:92552787-92552809 CTAAGATTATTCAGGAATAAAGG + Intergenic
1132391345 15:101440647-101440669 TTAATATTATTCAGAGACTTCGG - Intronic
1135730024 16:24886350-24886372 CTAATAAAATGCAGAGAAAAGGG + Intronic
1136860840 16:33701557-33701579 ACCATGTTATTCAGAGAAAAAGG - Intergenic
1137987128 16:53118490-53118512 CTAATGGTAACCAGAGAAAAAGG + Intronic
1138259649 16:55606608-55606630 CCTATATTTTACAGAGAAAAAGG + Intergenic
1139091773 16:63657431-63657453 CTTTTATTATTTAGAGAAATCGG - Intergenic
1139117064 16:63967840-63967862 TTGATGTTATTAAGAGAAAATGG + Intergenic
1139630372 16:68228167-68228189 CTAAAGTTAGTTAGAGAAAAAGG + Exonic
1141201499 16:81901907-81901929 GCATTATTATTCTGAGAAAAGGG + Intronic
1141406396 16:83797515-83797537 CTAATAGTTTCCAGAAAAAAAGG + Intronic
1145093730 17:20007744-20007766 CTTAAATTGTTCAGAGTAAAAGG + Intergenic
1145253543 17:21310307-21310329 CTATTATAATTTAGAGAAATTGG - Intronic
1148947690 17:51279054-51279076 ACAATATTAATTAGAGAAAAAGG - Intronic
1149325385 17:55524705-55524727 CCATTATTACTAAGAGAAAATGG + Intergenic
1150538546 17:66072598-66072620 CTAATATGATGCAATGAAAAAGG - Intronic
1151004368 17:70416932-70416954 GGAATATTACTCAGCGAAAAGGG + Intergenic
1153271066 18:3321963-3321985 CTAATTATATTTAAAGAAAAGGG - Intergenic
1153668570 18:7388432-7388454 GTAAGATTTTTCAGAGAAAAAGG - Intergenic
1154280226 18:12996009-12996031 CCCATCTTATTCAGAGTAAAAGG - Intronic
1154436658 18:14348555-14348577 CTAAAATTATTCTGAGAACCAGG + Intergenic
1156821592 18:41379474-41379496 CTGAAAGAATTCAGAGAAAATGG + Intergenic
1158143604 18:54285010-54285032 CTAACTGTATTTAGAGAAAATGG + Intronic
1158757191 18:60339745-60339767 ATCATATTATTCAAAGAAATTGG + Intergenic
1159065701 18:63565907-63565929 GTCAGAATATTCAGAGAAAAGGG - Intronic
1159318841 18:66819034-66819056 CTAATATGATGCGAAGAAAAGGG - Intergenic
1159351606 18:67282137-67282159 CTAATATTACTCAAAATAAAGGG + Intergenic
1159488409 18:69097093-69097115 CTAATATATTTCACATAAAAGGG + Intergenic
1159994206 18:74947156-74947178 CTAAGATTATGCAAATAAAAAGG - Intronic
1160170796 18:76552350-76552372 ATAAAACTCTTCAGAGAAAACGG + Intergenic
1160315544 18:77842246-77842268 CTAATACTATTCATAGATAAAGG + Intergenic
1160359519 18:78260940-78260962 GCAATATTTTTCAGAGTAAAAGG - Intergenic
1161763147 19:6189133-6189155 ATAATATTAATCAGAGAAGAAGG - Intronic
1162116550 19:8433228-8433250 ATAATATTAATAAAAGAAAAAGG + Intronic
1162264315 19:9558657-9558679 ACAGGATTATTCAGAGAAAAAGG + Intergenic
1164123573 19:22289539-22289561 CTAAACTCATTCTGAGAAAAGGG - Intronic
1165858860 19:38896295-38896317 CTAATATTTTTTACAGAAATAGG + Intronic
1165990481 19:39809275-39809297 CCAATATAATTCAGAGGAAGTGG + Intergenic
1167407216 19:49319825-49319847 CTAATTCTATTGAGAAAAAAAGG - Intronic
1167559808 19:50219505-50219527 CCAATATTGTTCGGAGAAAGAGG - Intronic
1168495586 19:56845795-56845817 ATAATATTAGTAATAGAAAAAGG - Intergenic
1202636210 1_KI270706v1_random:46854-46876 CTAATGCTGTGCAGAGAAAAAGG - Intergenic
1202678271 1_KI270711v1_random:27180-27202 CAAATATTTATCAGAGAACAAGG - Intergenic
926585368 2:14680132-14680154 TTCATTTTATACAGAGAAAATGG + Intergenic
926593625 2:14765725-14765747 CTTTTATGATTGAGAGAAAATGG + Intergenic
926618787 2:15027500-15027522 CTATAATTATTAAGAGAATATGG - Intergenic
927350466 2:22106242-22106264 CTTTTATTTTTCACAGAAAATGG + Intergenic
929742033 2:44612503-44612525 GTAATATTATTCAGAGTGAGAGG - Intronic
929811043 2:45189609-45189631 TTAATCTTATCCAGAGTAAAGGG - Intergenic
929910415 2:46084948-46084970 CTAAAAAGATTCAGAGAAAAAGG - Intronic
929975370 2:46628711-46628733 TTATTATTATTTAGAGAATATGG - Intergenic
931127182 2:59291143-59291165 CTAAGCTTATTCAAAGAAAATGG + Intergenic
931545264 2:63376769-63376791 CTAATGTCATTCAGATGAAAAGG + Intronic
931880619 2:66566535-66566557 TTAATATTATGCAGAACAAACGG + Intronic
932994652 2:76836208-76836230 CTAATATTCTACTGACAAAAAGG - Intronic
933009798 2:77045987-77046009 TTAATATAATTAAAAGAAAAAGG - Intronic
933380495 2:81537117-81537139 GTAATATTTTTCAGAGCATATGG - Intergenic
933395324 2:81723822-81723844 CAAATATTATATAGAGAGAATGG + Intergenic
933764977 2:85701063-85701085 CTGAAATGATTCAGAAAAAAAGG + Intergenic
933977038 2:87520063-87520085 CTAATATTAACCAAAGGAAATGG + Intergenic
935406364 2:102714156-102714178 ATAATATTATTAAGTGGAAATGG - Intergenic
935683705 2:105664329-105664351 CTTATATTTTTCTGAGAAAGTGG - Intergenic
935818174 2:106867405-106867427 CTGAAATGATTCAGAGAAAGGGG - Intronic
936157809 2:110060396-110060418 ATAATATTAGTCAGGGATAAAGG - Intergenic
936186883 2:110311048-110311070 ATAATATTAGTCAGGGATAAAGG + Intergenic
936316779 2:111430742-111430764 CTAATATTAACCAAAGGAAATGG - Intergenic
936643493 2:114342776-114342798 CTACCATGATCCAGAGAAAAGGG + Intergenic
938574970 2:132595300-132595322 CTAATGTTATTCTGAAAAAAAGG - Intronic
939318089 2:140578915-140578937 CTCATATTTTTCAGAGAGAAAGG + Intronic
939491988 2:142887264-142887286 TTAATAGTAGTCATAGAAAAGGG - Intronic
939580423 2:143939839-143939861 CCAATATAATTCAGAATAAAAGG - Exonic
939756216 2:146115603-146115625 CCAATATCATTTAGAGACAAAGG + Intergenic
940438290 2:153681437-153681459 AGAATATTAAACAGAGAAAATGG - Intergenic
941226320 2:162854202-162854224 ATAATATTCTTTAGAAAAAAGGG - Intergenic
941393188 2:164942068-164942090 CTAATATTTTTCAAATAAATCGG + Intronic
941724677 2:168848591-168848613 GGAATATTATTCAGCCAAAAAGG + Intronic
942265501 2:174220322-174220344 AGATTATTATTCAGAGTAAATGG - Intronic
942430423 2:175905526-175905548 CTGAGAATATTCAGAGAAATAGG + Intergenic
943156934 2:184192415-184192437 CTAAAATTACTAAGAAAAAATGG + Intergenic
944944173 2:204664024-204664046 CTCATATTGTTCAAAGAATAGGG + Intronic
945045821 2:205780950-205780972 CAAATGTTATTTAGACAAAAGGG - Intronic
945287971 2:208101149-208101171 CTGATTGTATTCAGAGATAATGG - Intergenic
945405190 2:209438503-209438525 CTAATTATATTCCCAGAAAAAGG - Intronic
945707936 2:213258873-213258895 CTACTATGATTAGGAGAAAAAGG + Intergenic
945854688 2:215054848-215054870 ATATTTTTATTCAGAGAAAATGG + Intronic
945857696 2:215088140-215088162 AGAATATTAAGCAGAGAAAATGG + Intronic
947220294 2:227785304-227785326 GTAAAATGATTCAGAGAAAAGGG - Intergenic
947266029 2:228282890-228282912 TTCTTATTATTCAGAGAAAGTGG + Intergenic
947868420 2:233418015-233418037 TTAATAATATTCACAGAAAAAGG - Intronic
948377515 2:237531224-237531246 CTACAGTTATTCTGAGAAAAGGG + Intronic
1169590409 20:7134594-7134616 CAAAAATTATTCTGAGTAAAGGG - Intergenic
1169637759 20:7712068-7712090 TTAAAATTATTCACAGAAGATGG + Intergenic
1170286668 20:14717603-14717625 CTAATCTTTTTCAGAGAGAGAGG + Intronic
1170974115 20:21145037-21145059 ATATTTTTATTCATAGAAAATGG + Intronic
1171388919 20:24788658-24788680 ATAATAATAATCAGAGCAAACGG + Intergenic
1171882346 20:30627793-30627815 CTAATGCTGTGCAGAGAAAAAGG - Intergenic
1172450349 20:35018284-35018306 CTGGTATTGTTAAGAGAAAAGGG - Intronic
1172541413 20:35720155-35720177 CTAAAATTATTGAGTGGAAAAGG + Intronic
1172914838 20:38435767-38435789 CTGACATTGTTCAGAAAAAAAGG - Intergenic
1174268205 20:49347310-49347332 CTAGCATTATTTTGAGAAAAGGG + Intergenic
1174323689 20:49762208-49762230 CTAATATTATTACTAGAAAGGGG + Intergenic
1174470907 20:50759880-50759902 CTAATATTTTTCGGAGAGACAGG + Intergenic
1174986544 20:55460566-55460588 CTAAAATGATTTAGAGGAAAAGG - Intergenic
1175035513 20:55996716-55996738 ATAATTTTTTTCAGAGAAAGAGG + Intergenic
1175081468 20:56424024-56424046 TTAATATTAATCACAAAAAAAGG + Intronic
1175652687 20:60740134-60740156 ATAATATTATTCAGTCACAAAGG - Intergenic
1176699955 21:10034063-10034085 CTAAAATTATTTGGATAAAAAGG + Intergenic
1176840385 21:13837100-13837122 CTAAAATTATTCTGAGAACCAGG - Intergenic
1177217969 21:18153773-18153795 TTAATATTATTCATAGAAAAGGG - Intronic
1177434076 21:21027827-21027849 CAATTATAATTCAGAGGAAAGGG - Intronic
1177455277 21:21329824-21329846 ATAATATTTTTCATAGAAATAGG + Intronic
1177645752 21:23898365-23898387 CTGTTATAATTCAGAGAACAAGG - Intergenic
1177648509 21:23931062-23931084 GTAATCTTATTGAGAGATAATGG - Intergenic
1177826896 21:26094213-26094235 TTACTTTTATTCAGAGATAAGGG + Intronic
1177935548 21:27340888-27340910 TAAATATTATTCAGCGATAAAGG + Intergenic
1179137068 21:38688997-38689019 GTACTATTATTCAGAAAAACTGG + Intergenic
1179178318 21:39024521-39024543 AAACTATTATTCAGAGACAATGG + Intergenic
1179565827 21:42248038-42248060 CTAATATTATACAAAAGAAAAGG + Intronic
1180111113 21:45652147-45652169 CTTATATTATTCAGACAGAATGG + Intronic
1182131619 22:27857122-27857144 CTAATATTAGTATGAGAAATTGG + Intronic
949386738 3:3511246-3511268 CTGATGTTATTCAGGGAATATGG + Intergenic
949641504 3:6040628-6040650 TTAATAATATTCAAGGAAAATGG + Intergenic
950880412 3:16318336-16318358 ATTATATAATTGAGAGAAAAAGG + Intronic
951181651 3:19665998-19666020 CTATTATTATTCATACAAATAGG + Intergenic
951663999 3:25101927-25101949 TTAAAATAATTCAGAGTAAAGGG + Intergenic
952018770 3:28991473-28991495 TCAACATTATTCTGAGAAAAAGG - Intergenic
952283866 3:31948950-31948972 ATTTGATTATTCAGAGAAAAGGG + Intronic
953836755 3:46352798-46352820 CTAAGATTGTGCAGAGAACATGG - Intergenic
954252539 3:49379185-49379207 GGAATATTATTCAGCGATAAAGG + Intronic
955030022 3:55207048-55207070 CTAATAAAATTAAGAGAAAATGG - Intergenic
956549348 3:70441066-70441088 ATAAAATTATTCAGGGAATAGGG + Intergenic
957276919 3:78102236-78102258 TTAAGATTATTAAGAGAAACAGG - Intergenic
957385806 3:79495569-79495591 CTAATATAATTAAGACATAAGGG + Intronic
958993010 3:100869523-100869545 CTAATATTATTTTGCAAAAACGG + Intronic
959407955 3:105984481-105984503 ATAATATTCTTCACAGAAATAGG + Intergenic
959542589 3:107557379-107557401 CTAACATTAGTTAGAGAAATTGG + Intronic
959596521 3:108135067-108135089 CCCAAAATATTCAGAGAAAAGGG - Intergenic
962447237 3:135477757-135477779 ATAATACTAGTCAGAGAAATTGG - Intergenic
962507778 3:136065641-136065663 CTAATTTGATTAAGAAAAAAGGG + Intronic
963372508 3:144419149-144419171 CTAAGATTATGCAGATTAAATGG + Intergenic
963612816 3:147493598-147493620 CTAATATTATTCAGAGAAAAGGG - Intronic
963654633 3:148030522-148030544 CTAATATTATTCTTGGAAAAAGG - Intergenic
963712508 3:148762868-148762890 CTAACATTATTCATATAAATGGG - Intergenic
963800118 3:149667782-149667804 CTAAAATCATTCACAAAAAATGG - Intronic
964234863 3:154513154-154513176 TTTATATTACTCAGTGAAAATGG + Intergenic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
964801176 3:160559926-160559948 CTCATATTAACCACAGAAAAAGG + Intronic
964898002 3:161621589-161621611 GTATTATTATTCAAAGAAATTGG - Intergenic
965019453 3:163209474-163209496 CTAATTTTATCCAGGGAAAAAGG - Intergenic
965028781 3:163336066-163336088 TTAAATTTATTCACAGAAAATGG + Intergenic
965477421 3:169174265-169174287 CTAATATAAGCCAGAGACAAAGG - Intronic
965686682 3:171311233-171311255 ATAATGTTAATCAGTGAAAAAGG - Intronic
965918189 3:173877225-173877247 CTCATATGATACACAGAAAAGGG + Intronic
966088493 3:176101437-176101459 CTGATATTATTCACAGTAAAGGG - Intergenic
966127549 3:176597224-176597246 TTACTATTATTAAGTGAAAATGG - Intergenic
967696624 3:192539693-192539715 CTAAAACTATTCAGAAAAATAGG - Intronic
970032150 4:11688234-11688256 GGAATATTATTCAGAGATAAAGG + Intergenic
970642521 4:18082961-18082983 CTAATATTATTCACAAACACAGG + Intergenic
970654737 4:18218671-18218693 GTGATAAGATTCAGAGAAAAAGG + Intergenic
971362181 4:25948340-25948362 AGAATATTATTCAGCCAAAAAGG - Intergenic
971397614 4:26243281-26243303 CTATTGTTATTCAGAGATGATGG + Intronic
971543707 4:27856858-27856880 ATAAAATTATTCACAGAAACAGG - Intergenic
971627517 4:28941495-28941517 CCAAAACTTTTCAGAGAAAAGGG + Intergenic
971754394 4:30688754-30688776 TTAATACTACTCAGAGATAAAGG - Intergenic
971760083 4:30754610-30754632 ATAATACTATTCAGGGAAATAGG + Intronic
971913871 4:32841725-32841747 CTAATAATATTGGGACAAAAAGG - Intergenic
971916762 4:32880308-32880330 ATATTTTTATTCAGATAAAATGG + Intergenic
972106936 4:35500018-35500040 ATAATTTCATTCAGAGAAAATGG - Intergenic
972234853 4:37120036-37120058 GTAATATTCTATAGAGAAAAAGG - Intergenic
972352754 4:38252082-38252104 TTAATAATATTGAGAGAAAAGGG - Intergenic
972860692 4:43166139-43166161 CCAATAGTATTAAGAGAATAAGG - Intergenic
973366015 4:49210240-49210262 CTAATGCTGTGCAGAGAAAAAGG - Intergenic
973394582 4:49582211-49582233 CTAATGCTGTGCAGAGAAAAAGG + Intergenic
973972306 4:56225584-56225606 CAAATATTATACAAAGAATAAGG - Intronic
974383385 4:61172150-61172172 AAAACATTATTCAGAGTAAAAGG + Intergenic
974395685 4:61331911-61331933 ATAATATTAATGAGAGAAATGGG + Intronic
974595343 4:64007680-64007702 ATAAAATTAATCAGAGAAGAAGG + Intergenic
974731661 4:65874970-65874992 CTAACATCTTTCAGACAAAAGGG - Intergenic
974750751 4:66137771-66137793 CTGACATTATACAGAGACAAAGG + Intergenic
975897652 4:79113635-79113657 CTACAAATATTCACAGAAAATGG + Intergenic
976325399 4:83765414-83765436 CTGATATTTTTCACAGCAAAAGG - Intergenic
976690968 4:87866646-87866668 GGAATATAAATCAGAGAAAATGG - Intergenic
977068766 4:92354805-92354827 CTAACATAATACAGACAAAATGG + Intronic
977176291 4:93824384-93824406 CTCAAAGTATTCAGAAAAAATGG - Intergenic
977477787 4:97535647-97535669 CTGAAATCAGTCAGAGAAAAAGG - Intronic
977599937 4:98925409-98925431 TTAATATTAGTCTGTGAAAATGG - Intronic
977621375 4:99141514-99141536 TTTATTTTATTCAGAAAAAATGG - Intronic
977992755 4:103464732-103464754 ATAAAAGTATTCAGAGAAGAAGG + Intergenic
978685089 4:111431687-111431709 CTAATTATCTTCAGAGAATAGGG - Intergenic
978783917 4:112587673-112587695 CCTAGATTCTTCAGAGAAAAAGG + Exonic
979051710 4:115943393-115943415 ATAAAATTAGTCAGAGAAAAAGG + Intergenic
979343983 4:119563607-119563629 ATAATAGAATTCAGAGAAAGTGG + Intronic
979414838 4:120424082-120424104 TTAATATTTTTGAGATAAAAAGG - Intergenic
979475037 4:121146139-121146161 CTAATTTCTTACAGAGAAAATGG + Intronic
979520219 4:121657496-121657518 AGAATATTATTCAGAAAACAAGG + Intergenic
979602145 4:122597859-122597881 CTAATAATATTAAATGAAAATGG - Intergenic
979870883 4:125820257-125820279 CTAATTTTATTCAGGGAATAAGG - Intergenic
979986919 4:127326435-127326457 ATAATATTATTCAAATAATATGG - Intergenic
980372359 4:131892677-131892699 CTAAAATTATTTGGATAAAAAGG + Intergenic
981354087 4:143766763-143766785 GGAATATTATTCAGCAAAAAAGG - Intergenic
982088794 4:151862548-151862570 TTATTATTATTCAGAGACAGAGG + Intergenic
982423920 4:155234316-155234338 CAAATATGGCTCAGAGAAAATGG - Intergenic
982645039 4:158013006-158013028 TTAATATTATTTAGAGAAGCAGG + Intergenic
982866433 4:160518339-160518361 TTAATAGTGTTCAGTGAAAATGG - Intergenic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983451604 4:167918583-167918605 ATAAAATTAATCAGAGAAGAAGG - Intergenic
984509800 4:180665915-180665937 CTAATATTTTCTAGAGAAACTGG + Intergenic
984637803 4:182132150-182132172 GTAATGTTATTTAGAGAAATTGG + Intergenic
985217415 4:187668811-187668833 ATAATTTACTTCAGAGAAAAAGG - Intergenic
985284185 4:188318251-188318273 TCAATATTATTCTGAGTAAATGG + Intergenic
1202763524 4_GL000008v2_random:132721-132743 CTAATGCTGTGCAGAGAAAAAGG - Intergenic
986189935 5:5486756-5486778 CTAATATTTTTCACAGCAGATGG - Exonic
986320022 5:6623118-6623140 CTAATTATATTAAGAAAAAATGG + Intronic
987026284 5:13929935-13929957 ATAATATTATTCCCAGAATATGG - Intronic
987485543 5:18521187-18521209 GTATTATAATGCAGAGAAAAAGG - Intergenic
987580158 5:19779914-19779936 CATATATTATTCATATAAAATGG - Intronic
988100856 5:26675707-26675729 CTAATAATATTTACAGATAAAGG - Intergenic
988176857 5:27738662-27738684 ATATTATTATGCAGAGGAAAAGG - Intergenic
988265608 5:28945591-28945613 ATAATATAATTCAAACAAAAGGG - Intergenic
988561185 5:32282907-32282929 TCAATATTCTTAAGAGAAAACGG + Intronic
988875231 5:35437715-35437737 AAAATATTATGAAGAGAAAATGG - Intergenic
990131298 5:52588953-52588975 ATAATGTTATTCAGATAAATAGG - Intergenic
991545156 5:67773494-67773516 CTAAGATGACTCAGGGAAAATGG + Intergenic
991911241 5:71563446-71563468 CTTATTATATTCAGGGAAAAAGG + Intronic
992226742 5:74626032-74626054 CTATTACTATTCAAAGTAAAAGG + Intergenic
993305822 5:86273524-86273546 CTAATTTCATTTACAGAAAATGG + Intergenic
993748886 5:91641078-91641100 CTAAAATTCTTTGGAGAAAAAGG + Intergenic
994128963 5:96202012-96202034 CTAAAATTGTTCTGAGCAAAGGG + Intergenic
994222717 5:97214932-97214954 TTAATATTTTTCAAAAAAAATGG - Intergenic
994397110 5:99234204-99234226 CTCCTAATATTCAGAGAAGAAGG + Intergenic
994488877 5:100416326-100416348 TTAATATATTCCAGAGAAAATGG + Intergenic
994518644 5:100801023-100801045 CTCCCATTATTCACAGAAAAGGG + Intergenic
995943711 5:117616434-117616456 CCAATATTATTAAAAGAGAAGGG + Intergenic
996016704 5:118547086-118547108 CTATTATCAATCAGAGAAAAAGG + Intergenic
996068876 5:119111897-119111919 CTAATAGTGTTTAGAGAAATAGG + Intronic
996119825 5:119658588-119658610 CAAATCTTATGGAGAGAAAAGGG + Intergenic
996266873 5:121551896-121551918 CTGATATATTTCAGGGAAAAGGG + Intergenic
996314371 5:122145145-122145167 CTAAAATTATTCATAGTGAAGGG + Intronic
997023503 5:130029958-130029980 TTTATAATATTCAAAGAAAAAGG - Intronic
998698634 5:144670784-144670806 TTAACTTTCTTCAGAGAAAAGGG - Intergenic
998923408 5:147096092-147096114 CTCATCTTATTCAGAGAATAAGG - Intergenic
999540177 5:152562880-152562902 GTAATACTATTCATAGAAATAGG + Intergenic
1000627223 5:163552857-163552879 TTAATATTTTTCAGAACAAAAGG - Intergenic
1000721667 5:164715669-164715691 TTTTTATTATACAGAGAAAAGGG + Intergenic
1001261157 5:170230258-170230280 CTAATGTTAATCAAACAAAAGGG - Intergenic
1001689302 5:173620865-173620887 CTGATACAATACAGAGAAAAAGG + Intergenic
1002558979 5:180067752-180067774 TTCAAAATATTCAGAGAAAAAGG - Intronic
1002923627 6:1592015-1592037 CCAAAATTCTTTAGAGAAAAGGG - Intergenic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003703707 6:8499369-8499391 CTAAAATTATTCATAGATAGTGG - Intergenic
1003937441 6:10990050-10990072 TTAAAATTATTTAGACAAAAAGG + Intronic
1006106473 6:31719859-31719881 CTATTATTATACTGAGAAAACGG - Intronic
1008385230 6:50881428-50881450 AAAATATTATACAGAGAACAAGG - Intergenic
1008469662 6:51869568-51869590 CCAATACTATTCAGTGAAAAGGG + Intronic
1008713652 6:54261784-54261806 ATAAAATTATCAAGAGAAAAAGG + Intronic
1008714349 6:54270806-54270828 CTAATAATATTTACATAAAAGGG + Intergenic
1008731508 6:54488462-54488484 TTAATATTCATCAGAGATAATGG + Intergenic
1008903353 6:56648402-56648424 CTCTTATTATACAGAGAAAATGG - Intronic
1009192391 6:60645117-60645139 AAAATATTATTAAGAGAAATTGG - Intergenic
1009196217 6:60688985-60689007 CTAAAATTCATCAGAGGAAAAGG - Intergenic
1009278982 6:61722540-61722562 ATAAAAATATTTAGAGAAAATGG - Intronic
1009576402 6:65467284-65467306 CTAATCATATGCAGAGAAACTGG + Intronic
1009585205 6:65592226-65592248 CTAACAGCATTCAGAGTAAAAGG + Intronic
1009629836 6:66181788-66181810 CTAATAATAATTAGAAAAAATGG - Intergenic
1009796523 6:68476098-68476120 CTAATGTCATTTATAGAAAAAGG - Intergenic
1010516584 6:76780229-76780251 GGAATATTATTCAGCCAAAAAGG + Intergenic
1010579774 6:77581358-77581380 CTACTATTAATTAGAGATAACGG - Intergenic
1010857505 6:80859434-80859456 CGAATATTATTCATTGAAATTGG - Intergenic
1011573293 6:88763547-88763569 CTAATTTTTTTCAGAGACAGTGG + Intronic
1011730641 6:90259498-90259520 CCAATATTCATCAGAGAAATTGG + Intronic
1011854547 6:91673001-91673023 CAAATATTATTGAGAAAAATCGG - Intergenic
1012138409 6:95588929-95588951 AAAATATTATACAGGGAAAAAGG - Intronic
1012568163 6:100686497-100686519 ATAATATGGTTCAGTGAAAAAGG - Intronic
1014299030 6:119657310-119657332 CTAATATAATTGATTGAAAAGGG - Intergenic
1014983674 6:127976572-127976594 ATAATTTTATTCAGACAACAGGG - Intronic
1015091301 6:129362544-129362566 CTAATATTTTTGTGAGAGAAGGG - Intronic
1015611358 6:135024115-135024137 ATAATATTTTTCTGAGAAAAGGG + Intronic
1015751507 6:136564490-136564512 CAAATATTATCCAAAGAAATGGG + Intronic
1015854379 6:137607916-137607938 CTAAAAGTATTCAGAAAAATTGG - Intergenic
1015996731 6:139002443-139002465 CTAATATTATAAAGACAAAGAGG - Intergenic
1016039700 6:139420143-139420165 TTATTATTATTTAGAGTAAACGG + Intergenic
1016564169 6:145434202-145434224 TGAAAATCATTCAGAGAAAAAGG - Intergenic
1016747481 6:147596514-147596536 AATATATTTTTCAGAGAAAATGG + Intronic
1017227249 6:152036486-152036508 CAAATATTATGCTGAGAATATGG + Intronic
1017337897 6:153283453-153283475 CAAATGTTTTTCAGAGACAAGGG + Intergenic
1017956985 6:159186946-159186968 ATTATTTTATTCAGACAAAAAGG - Intronic
1018759706 6:166882115-166882137 CAAATATTAATCAAAGGAAATGG + Intronic
1019880072 7:3851359-3851381 CTTATATTATTAACATAAAAAGG - Intronic
1021110227 7:16685466-16685488 CAAATTCTATTCAGAGAAAATGG + Intronic
1021180749 7:17502869-17502891 CCAATATTATTAAGGGAAATGGG - Intergenic
1021476765 7:21070556-21070578 GTAATATTTTTTAGAGTAAATGG + Intergenic
1022124860 7:27346568-27346590 CTAATATTATTTAGATAAGGTGG + Intergenic
1023271509 7:38468482-38468504 CAATTATTATCCTGAGAAAATGG + Intronic
1023472046 7:40533949-40533971 GTGATAGTTTTCAGAGAAAATGG - Intronic
1024641224 7:51330215-51330237 CTCCTGTTTTTCAGAGAAAATGG + Intergenic
1026177710 7:68012593-68012615 CTTATATTACTCAAAGAAGAAGG + Intergenic
1027894530 7:84024180-84024202 GTGATAGGATTCAGAGAAAATGG + Intronic
1028010042 7:85630513-85630535 CTATTTTTATTCAGCCAAAATGG - Intergenic
1028167783 7:87558365-87558387 CTATCATTATTCAGAATAAATGG - Intronic
1028452156 7:90997688-90997710 CTAATATTATTCTCCCAAAAAGG - Intronic
1028556369 7:92130007-92130029 CAAGAATTTTTCAGAGAAAAAGG + Intronic
1028691346 7:93656191-93656213 CTTTTATTATTCTGATAAAATGG + Intronic
1030646788 7:112070476-112070498 CTAATATTTCTCAGGGAAATAGG + Intronic
1030788431 7:113692681-113692703 CTGAAATTATTCAGATTAAAAGG - Intergenic
1030973891 7:116096779-116096801 CTAATATTATAAATAGAAAGTGG + Intronic
1031519745 7:122749105-122749127 ATAATTTTATTCTAAGAAAAAGG + Intronic
1031652867 7:124313134-124313156 CTAAAATTATCCAGTGACAAAGG - Intergenic
1031655969 7:124355659-124355681 CAAATTTAATTCAAAGAAAATGG - Intergenic
1032183992 7:129707396-129707418 TTAATGGTATTCAAAGAAAAGGG + Intronic
1032325137 7:130920999-130921021 CTTATGCTTTTCAGAGAAAAGGG - Intergenic
1032582092 7:133112834-133112856 CCAATTTTATTTAGAGATAAAGG - Intergenic
1032596905 7:133250862-133250884 CTAATATTAGACACAAAAAAAGG - Intergenic
1033734959 7:144213309-144213331 CTCATATTCTGCAGAGAGAAAGG + Intergenic
1033748097 7:144337660-144337682 CTCATATTCTGCAGAGAGAAAGG - Intergenic
1033765017 7:144479415-144479437 CTTATATTATCTAAAGAAAAAGG - Intronic
1033766556 7:144498956-144498978 CTTATATTTTTAAAAGAAAAAGG - Intronic
1033852239 7:145511752-145511774 ATAAAATAATTCAGAAAAAAGGG + Intergenic
1034787468 7:153938083-153938105 ATCATATTCTTCAGAGAGAAAGG - Intronic
1034911022 7:154998919-154998941 GGCATATTATTCAGAGTAAAAGG - Intronic
1034925692 7:155119676-155119698 ACAAAATTAATCAGAGAAAAAGG + Intergenic
1035134762 7:156691862-156691884 CTAATATTATTTCAAAAAAATGG - Intronic
1035661654 8:1352615-1352637 CAAAGCTTATTCAGAGAAATGGG - Intergenic
1036080466 8:5549637-5549659 CAAGTATTTTTCATAGAAAATGG - Intergenic
1036253102 8:7180768-7180790 ATTATATTATTCACAGAAACAGG + Intergenic
1036364394 8:8106705-8106727 ATTATATTATTCACAGAAACAGG - Intergenic
1037057449 8:14459726-14459748 CTAATATGATACACTGAAAAGGG + Intronic
1037414325 8:18632845-18632867 ATCATAATATTCAAAGAAAAAGG + Intronic
1037791179 8:21943935-21943957 CTAATAATGTTTGGAGAAAAGGG + Intronic
1037946012 8:22990227-22990249 CTCATATTTTTCAGAGAAAAGGG + Intronic
1038095438 8:24304429-24304451 CTAAATTTATACAGAGAGAATGG - Intronic
1038223234 8:25630600-25630622 CTAATATACTTCAGAGAATAGGG - Intergenic
1038558012 8:28541589-28541611 ATAAGATTATACAGAAAAAAGGG - Intronic
1038724662 8:30069853-30069875 ATAATAATAATCAGAGAAAGAGG + Exonic
1039748496 8:40455063-40455085 CGAATAGTATTCAGAGTAAAAGG + Intergenic
1039913951 8:41845969-41845991 CTTCTATTTTGCAGAGAAAATGG - Intronic
1040404417 8:47086224-47086246 CTAATGCTGTACAGAGAAAAGGG - Intergenic
1040464199 8:47679252-47679274 CTCATATTATTCATCAAAAAAGG - Intronic
1041810774 8:61906977-61906999 TTAATATTATTTCCAGAAAATGG - Intergenic
1042474445 8:69231226-69231248 CAAAGATTATTAAGAGATAAAGG + Intergenic
1042623323 8:70730075-70730097 CTAAAACTCTTCAGAGTAAAGGG - Intronic
1042647175 8:70999932-70999954 CTATTTTTAATAAGAGAAAAGGG - Intergenic
1042682500 8:71401500-71401522 CTAATATGTTTCAGAGGAAAAGG - Intergenic
1044017517 8:87062365-87062387 CTTACATTATTAAGAAAAAATGG + Intronic
1044071344 8:87763932-87763954 CTAGTTTTATACAGAAAAAAAGG - Intergenic
1044082156 8:87898425-87898447 CTAATAATACTAAGAGAAACAGG + Intergenic
1044559574 8:93599545-93599567 GTAATCATATTCAGAGAAAAAGG + Intergenic
1045123262 8:99062218-99062240 CTAATCTTATTTACAGGAAATGG - Intronic
1045127556 8:99109313-99109335 CAATTATTATTCAGTGAAAGAGG - Intronic
1046218779 8:111184967-111184989 CTAATAGTATTCTGACTAAAGGG + Intergenic
1046382061 8:113464232-113464254 ATAAAATTAATCAGGGAAAAAGG - Intergenic
1046546612 8:115659662-115659684 TTAAGAGTATTGAGAGAAAATGG + Intronic
1047005787 8:120618876-120618898 TTGATATTTTTCTGAGAAAATGG - Intronic
1048087977 8:131204555-131204577 ATAATATTAGTAAGATAAAATGG - Intergenic
1048400980 8:134070379-134070401 CTAATTTGTTTCAGAAAAAATGG - Intergenic
1048561489 8:135542771-135542793 GTAATATTAATTATAGAAAACGG + Intronic
1049939359 9:530266-530288 TTAATATCATGAAGAGAAAAAGG + Intronic
1050389752 9:5128863-5128885 TTAATATTCTTCAGAAACAAGGG + Intergenic
1050441902 9:5672816-5672838 GAAAAATCATTCAGAGAAAAGGG + Intronic
1050690253 9:8219584-8219606 CTAAAGTTATTCTGAAAAAAAGG + Intergenic
1052348364 9:27432991-27433013 ATAATATTCTCAAGAGAAAAGGG - Intronic
1052732544 9:32306770-32306792 ATAAAATTAATCAGAGAATAAGG + Intergenic
1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG + Intergenic
1053637097 9:40020527-40020549 CTAAAATTATTTGGATAAAAAGG + Intergenic
1053768934 9:41444397-41444419 CTAAAATTATTTGGATAAAAAGG - Intergenic
1053918257 9:42961626-42961648 CTAAAATTATTCTGAGAACTAGG + Intergenic
1054317927 9:63617371-63617393 CTAAAATTATTTGGATAAAAAGG + Intergenic
1054547602 9:66355871-66355893 CTAAAATTATTTGGATAAAAAGG - Intergenic
1054954451 9:70892275-70892297 GTAATATCATTCAGAAAAAGAGG + Intronic
1055378246 9:75674878-75674900 CCAATATTCATCAGAGAAATTGG + Intergenic
1056290021 9:85133895-85133917 CTAATTTTATTCTTTGAAAAAGG - Intergenic
1056328059 9:85497737-85497759 CTAAACTAATTCAGAAAAAAAGG + Intergenic
1056415286 9:86369522-86369544 ATAAAATTAATCAGTGAAAAAGG - Intergenic
1058186260 9:101859293-101859315 CCATTATTATTCAGAAAAAAAGG + Intergenic
1058445701 9:105052989-105053011 ATAAAATTAATCAGAGAAGAAGG + Intergenic
1059860650 9:118457384-118457406 CTAAAAGGATTCAGAGAAGATGG + Intergenic
1060379640 9:123155185-123155207 TTAATATTTATCTGAGAAAATGG + Intronic
1060384508 9:123212045-123212067 CTTTTCTTATTCAGAGCAAAAGG - Intronic
1060705968 9:125801606-125801628 CTAATTTTATTATGAGAGAAGGG - Intronic
1060748852 9:126155677-126155699 TTAATATTATTCACAAAAAAAGG - Intergenic
1061104124 9:128515918-128515940 ATAAGCTTATTCTGAGAAAATGG + Intronic
1202784966 9_KI270719v1_random:4123-4145 CTAAAATTATTTGGATAAAAAGG + Intergenic
1185723026 X:2397005-2397027 CCATTTTTATTTAGAGAAAAGGG + Intronic
1185794495 X:2953504-2953526 GCAATATAATTCAGTGAAAAAGG + Intronic
1187345151 X:18457161-18457183 CTAGTACTATGCACAGAAAAAGG - Intronic
1187927558 X:24263859-24263881 CGAGTGTTATTCTGAGAAAATGG - Intergenic
1187990183 X:24862295-24862317 CTAATATTAATCAGTGAGAAAGG - Intronic
1188147071 X:26627448-26627470 TTAATATTATTGAGAGAATTTGG + Intergenic
1188164416 X:26844469-26844491 AAAATATTATTAAGAGAACAGGG - Intergenic
1188814121 X:34690041-34690063 TCAATATTAATCAGAGAAACTGG + Intergenic
1188821513 X:34780887-34780909 CAAGTAGTATTCAGAGAAATAGG + Intergenic
1189703817 X:43739511-43739533 CCCATGTTATTCAGAGAAATTGG + Intronic
1189960298 X:46318130-46318152 CTACTTTTATGCAGACAAAAGGG - Intergenic
1192179668 X:68908637-68908659 CTAATATCATCCAGAGAGAGGGG - Intergenic
1193642750 X:84031833-84031855 ACAATATTATTCAGAGATACTGG - Intergenic
1194231155 X:91325044-91325066 TTAATTTTATTCAGATAAACTGG + Intergenic
1194270906 X:91813810-91813832 CTATTTTTATTCAGAAGAAAAGG - Intronic
1194455937 X:94103379-94103401 CTAAAATTTCTCAGAGAAAAAGG - Intergenic
1194553225 X:95326839-95326861 TGAATATTCTTCAGAGAAATTGG + Intergenic
1194844994 X:98794627-98794649 TTAATAGTTTTCAGAAAAAAAGG - Intergenic
1195546480 X:106117542-106117564 ATAATAATTTTCAGAGATAATGG - Intergenic
1195607032 X:106817719-106817741 CTATGAATATTCAGAGAAAATGG + Intronic
1196774248 X:119323594-119323616 GTAATTTTTTTCAGAGAAGAGGG - Intergenic
1197469132 X:126846270-126846292 CTAAAAATAGCCAGAGAAAATGG + Intergenic
1198486268 X:137090514-137090536 CTTATACTCTTCAGAGGAAAAGG - Intergenic
1198682113 X:139194265-139194287 ATTATAATATGCAGAGAAAAAGG + Intronic
1199001168 X:142638341-142638363 GTAAAATTATTCAGATAATATGG - Intergenic
1199001628 X:142645222-142645244 TTAAATTTATTCAGAAAAAAAGG - Intergenic
1199061959 X:143366854-143366876 AAAATATTCTTCAGAAAAAAAGG + Intergenic
1200588147 Y:5035246-5035268 CTATTTTTATTCAGAAGAAAAGG - Intronic
1200759083 Y:7020210-7020232 TTAAGACTATTTAGAGAAAATGG + Intronic