ID: 963613715

View in Genome Browser
Species Human (GRCh38)
Location 3:147507493-147507515
Sequence TTGGGGGGAGGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7429
Summary {0: 1, 1: 2, 2: 44, 3: 689, 4: 6693}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963613715 Original CRISPR TTGGGGGGAGGGAGGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr