ID: 963616178

View in Genome Browser
Species Human (GRCh38)
Location 3:147541269-147541291
Sequence ACACTTAAACATATGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963616178_963616181 0 Left 963616178 3:147541269-147541291 CCCTGATCCATATGTTTAAGTGT No data
Right 963616181 3:147541292-147541314 GTTTTTGTATTAGCTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963616178 Original CRISPR ACACTTAAACATATGGATCA GGG (reversed) Intergenic
No off target data available for this crispr