ID: 963623961

View in Genome Browser
Species Human (GRCh38)
Location 3:147647585-147647607
Sequence CTGTAAGCCCAGCTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963623961_963623965 -3 Left 963623961 3:147647585-147647607 CCCAGCCTCAGCTGGGCTTACAG No data
Right 963623965 3:147647605-147647627 CAGGCGTGTGCCACCACACCCGG 0: 994
1: 13461
2: 58285
3: 151258
4: 225185
963623961_963623970 27 Left 963623961 3:147647585-147647607 CCCAGCCTCAGCTGGGCTTACAG No data
Right 963623970 3:147647635-147647657 TTGTATTTTTAGTAGATATAAGG 0: 36
1: 5788
2: 160032
3: 229513
4: 126979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963623961 Original CRISPR CTGTAAGCCCAGCTGAGGCT GGG (reversed) Intergenic
No off target data available for this crispr