ID: 963624672

View in Genome Browser
Species Human (GRCh38)
Location 3:147656152-147656174
Sequence TGCAGGAAGTTCATGGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963624672_963624676 -9 Left 963624672 3:147656152-147656174 CCACAAGCCATGAACTTCCTGCA No data
Right 963624676 3:147656166-147656188 CTTCCTGCACTGGGCACCACAGG No data
963624672_963624679 19 Left 963624672 3:147656152-147656174 CCACAAGCCATGAACTTCCTGCA No data
Right 963624679 3:147656194-147656216 TCATATCAAAACACAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963624672 Original CRISPR TGCAGGAAGTTCATGGCTTG TGG (reversed) Intergenic
No off target data available for this crispr