ID: 963630306

View in Genome Browser
Species Human (GRCh38)
Location 3:147723189-147723211
Sequence GTTATCTGCAGAAGATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963630306_963630310 16 Left 963630306 3:147723189-147723211 CCCTGTAATCTTCTGCAGATAAC No data
Right 963630310 3:147723228-147723250 GACATCTTCTGGTCTGTTACTGG No data
963630306_963630312 23 Left 963630306 3:147723189-147723211 CCCTGTAATCTTCTGCAGATAAC No data
Right 963630312 3:147723235-147723257 TCTGGTCTGTTACTGGGCTTTGG No data
963630306_963630311 17 Left 963630306 3:147723189-147723211 CCCTGTAATCTTCTGCAGATAAC No data
Right 963630311 3:147723229-147723251 ACATCTTCTGGTCTGTTACTGGG No data
963630306_963630313 26 Left 963630306 3:147723189-147723211 CCCTGTAATCTTCTGCAGATAAC No data
Right 963630313 3:147723238-147723260 GGTCTGTTACTGGGCTTTGGTGG 0: 17
1: 155
2: 153
3: 106
4: 231
963630306_963630308 5 Left 963630306 3:147723189-147723211 CCCTGTAATCTTCTGCAGATAAC No data
Right 963630308 3:147723217-147723239 TCCTTTTGAGAGACATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963630306 Original CRISPR GTTATCTGCAGAAGATTACA GGG (reversed) Intergenic
No off target data available for this crispr