ID: 963630308

View in Genome Browser
Species Human (GRCh38)
Location 3:147723217-147723239
Sequence TCCTTTTGAGAGACATCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963630306_963630308 5 Left 963630306 3:147723189-147723211 CCCTGTAATCTTCTGCAGATAAC No data
Right 963630308 3:147723217-147723239 TCCTTTTGAGAGACATCTTCTGG No data
963630307_963630308 4 Left 963630307 3:147723190-147723212 CCTGTAATCTTCTGCAGATAACT No data
Right 963630308 3:147723217-147723239 TCCTTTTGAGAGACATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963630308 Original CRISPR TCCTTTTGAGAGACATCTTC TGG Intergenic
No off target data available for this crispr