ID: 963630310

View in Genome Browser
Species Human (GRCh38)
Location 3:147723228-147723250
Sequence GACATCTTCTGGTCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963630307_963630310 15 Left 963630307 3:147723190-147723212 CCTGTAATCTTCTGCAGATAACT No data
Right 963630310 3:147723228-147723250 GACATCTTCTGGTCTGTTACTGG No data
963630306_963630310 16 Left 963630306 3:147723189-147723211 CCCTGTAATCTTCTGCAGATAAC No data
Right 963630310 3:147723228-147723250 GACATCTTCTGGTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963630310 Original CRISPR GACATCTTCTGGTCTGTTAC TGG Intergenic
No off target data available for this crispr