ID: 963632688

View in Genome Browser
Species Human (GRCh38)
Location 3:147752763-147752785
Sequence AAGAGGAAACAGAAGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963632680_963632688 16 Left 963632680 3:147752724-147752746 CCAGTGAGGGGAAGATAAGAAGA No data
Right 963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963632688 Original CRISPR AAGAGGAAACAGAAGGAAAG GGG Intergenic
No off target data available for this crispr