ID: 963640146

View in Genome Browser
Species Human (GRCh38)
Location 3:147850913-147850935
Sequence TGACTTTGATTTAGTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963640141_963640146 29 Left 963640141 3:147850861-147850883 CCACATACTGCTTTATTCACACA No data
Right 963640146 3:147850913-147850935 TGACTTTGATTTAGTGCTGAAGG No data
963640140_963640146 30 Left 963640140 3:147850860-147850882 CCCACATACTGCTTTATTCACAC No data
Right 963640146 3:147850913-147850935 TGACTTTGATTTAGTGCTGAAGG No data
963640144_963640146 4 Left 963640144 3:147850886-147850908 CCAGTTGGTGGTTAACATAATGC No data
Right 963640146 3:147850913-147850935 TGACTTTGATTTAGTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963640146 Original CRISPR TGACTTTGATTTAGTGCTGA AGG Intergenic