ID: 963641059

View in Genome Browser
Species Human (GRCh38)
Location 3:147862318-147862340
Sequence AAGGGGTCCCAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963641051_963641059 1 Left 963641051 3:147862294-147862316 CCTGATAAGTAAGCAACAGTGAG No data
Right 963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG No data
963641050_963641059 11 Left 963641050 3:147862284-147862306 CCTGTGGAATCCTGATAAGTAAG No data
Right 963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963641059 Original CRISPR AAGGGGTCCCAGATGGAGGA GGG Intergenic
No off target data available for this crispr