ID: 963641304

View in Genome Browser
Species Human (GRCh38)
Location 3:147864066-147864088
Sequence CCTCATGGCCTTGAGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963641295_963641304 7 Left 963641295 3:147864036-147864058 CCAAAGGGTCCCTGAGACAGAAT No data
Right 963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG No data
963641293_963641304 16 Left 963641293 3:147864027-147864049 CCCTGAGAACCAAAGGGTCCCTG No data
Right 963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG No data
963641297_963641304 -3 Left 963641297 3:147864046-147864068 CCTGAGACAGAATCCCAATCCCT No data
Right 963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG No data
963641296_963641304 -2 Left 963641296 3:147864045-147864067 CCCTGAGACAGAATCCCAATCCC No data
Right 963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG No data
963641294_963641304 15 Left 963641294 3:147864028-147864050 CCTGAGAACCAAAGGGTCCCTGA No data
Right 963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963641304 Original CRISPR CCTCATGGCCTTGAGCTGAA GGG Intergenic
No off target data available for this crispr