ID: 963642261

View in Genome Browser
Species Human (GRCh38)
Location 3:147875445-147875467
Sequence CAGTTACTAATGATAGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963642261_963642263 11 Left 963642261 3:147875445-147875467 CCATTGGCTATCATTAGTAACTG No data
Right 963642263 3:147875479-147875501 AGGTATTAGAGATTCAACTATGG No data
963642261_963642265 30 Left 963642261 3:147875445-147875467 CCATTGGCTATCATTAGTAACTG No data
Right 963642265 3:147875498-147875520 ATGGTGACTTCAACACTTAAGGG No data
963642261_963642262 -9 Left 963642261 3:147875445-147875467 CCATTGGCTATCATTAGTAACTG No data
Right 963642262 3:147875459-147875481 TAGTAACTGTGTCTGACTGCAGG No data
963642261_963642264 29 Left 963642261 3:147875445-147875467 CCATTGGCTATCATTAGTAACTG No data
Right 963642264 3:147875497-147875519 TATGGTGACTTCAACACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963642261 Original CRISPR CAGTTACTAATGATAGCCAA TGG (reversed) Intergenic