ID: 963642262

View in Genome Browser
Species Human (GRCh38)
Location 3:147875459-147875481
Sequence TAGTAACTGTGTCTGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963642259_963642262 7 Left 963642259 3:147875429-147875451 CCTGTCTCTTGTCAGACCATTGG No data
Right 963642262 3:147875459-147875481 TAGTAACTGTGTCTGACTGCAGG No data
963642261_963642262 -9 Left 963642261 3:147875445-147875467 CCATTGGCTATCATTAGTAACTG No data
Right 963642262 3:147875459-147875481 TAGTAACTGTGTCTGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963642262 Original CRISPR TAGTAACTGTGTCTGACTGC AGG Intergenic