ID: 963642263 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:147875479-147875501 |
Sequence | AGGTATTAGAGATTCAACTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
963642259_963642263 | 27 | Left | 963642259 | 3:147875429-147875451 | CCTGTCTCTTGTCAGACCATTGG | No data | ||
Right | 963642263 | 3:147875479-147875501 | AGGTATTAGAGATTCAACTATGG | No data | ||||
963642261_963642263 | 11 | Left | 963642261 | 3:147875445-147875467 | CCATTGGCTATCATTAGTAACTG | No data | ||
Right | 963642263 | 3:147875479-147875501 | AGGTATTAGAGATTCAACTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
963642263 | Original CRISPR | AGGTATTAGAGATTCAACTA TGG | Intergenic | ||