ID: 963642264

View in Genome Browser
Species Human (GRCh38)
Location 3:147875497-147875519
Sequence TATGGTGACTTCAACACTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963642261_963642264 29 Left 963642261 3:147875445-147875467 CCATTGGCTATCATTAGTAACTG No data
Right 963642264 3:147875497-147875519 TATGGTGACTTCAACACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963642264 Original CRISPR TATGGTGACTTCAACACTTA AGG Intergenic