ID: 963642265

View in Genome Browser
Species Human (GRCh38)
Location 3:147875498-147875520
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963642261_963642265 30 Left 963642261 3:147875445-147875467 CCATTGGCTATCATTAGTAACTG No data
Right 963642265 3:147875498-147875520 ATGGTGACTTCAACACTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr