ID: 963661393

View in Genome Browser
Species Human (GRCh38)
Location 3:148132153-148132175
Sequence GACACCTCTTGACCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963661391_963661393 8 Left 963661391 3:148132122-148132144 CCTTCTGCAGATAACTACTGTCC No data
Right 963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG No data
963661390_963661393 11 Left 963661390 3:148132119-148132141 CCACCTTCTGCAGATAACTACTG No data
Right 963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG No data
963661389_963661393 15 Left 963661389 3:148132115-148132137 CCTGCCACCTTCTGCAGATAACT 0: 5
1: 186
2: 190
3: 119
4: 332
Right 963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG No data
963661388_963661393 16 Left 963661388 3:148132114-148132136 CCCTGCCACCTTCTGCAGATAAC 0: 4
1: 182
2: 175
3: 141
4: 266
Right 963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963661393 Original CRISPR GACACCTCTTGACCTGTTAC TGG Intergenic
No off target data available for this crispr