ID: 963664144

View in Genome Browser
Species Human (GRCh38)
Location 3:148160932-148160954
Sequence ATTAGGTTGTTGGTTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1193
Summary {0: 1, 1: 1, 2: 40, 3: 381, 4: 770}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963664144_963664148 6 Left 963664144 3:148160932-148160954 CCTTCAGCAACCAACAACCTAAT 0: 1
1: 1
2: 40
3: 381
4: 770
Right 963664148 3:148160961-148160983 GCAGACATCAACATCAAGGCAGG 0: 1
1: 10
2: 12
3: 40
4: 163
963664144_963664149 26 Left 963664144 3:148160932-148160954 CCTTCAGCAACCAACAACCTAAT 0: 1
1: 1
2: 40
3: 381
4: 770
Right 963664149 3:148160981-148161003 AGGACCCTCCAACCTCCAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 214
963664144_963664147 2 Left 963664144 3:148160932-148160954 CCTTCAGCAACCAACAACCTAAT 0: 1
1: 1
2: 40
3: 381
4: 770
Right 963664147 3:148160957-148160979 GCTAGCAGACATCAACATCAAGG 0: 1
1: 1
2: 16
3: 196
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963664144 Original CRISPR ATTAGGTTGTTGGTTGCTGA AGG (reversed) Intergenic
901348507 1:8569314-8569336 CTTTGGTTGTTGTTTGGTGACGG + Intronic
901751307 1:11411586-11411608 ATCAGGGTGGCGGTTGCTGAAGG - Intergenic
902092987 1:13918720-13918742 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
903560930 1:24226565-24226587 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
903853124 1:26320219-26320241 CTTATGTTGCTGGATGCTGAGGG - Exonic
903912202 1:26735939-26735961 ATTAGGTAGTAGTTTTCTGAAGG - Intronic
904760603 1:32801533-32801555 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
905086022 1:35377777-35377799 TTCAGGGTGATGGTTGCTGAAGG + Intronic
905545758 1:38798648-38798670 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
905709080 1:40085577-40085599 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
907366844 1:53968556-53968578 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
907649196 1:56277758-56277780 ATTAGGGTGGTGGTTGCTAAAGG + Intergenic
907858899 1:58331594-58331616 ATCAGGGTAGTGGTTGCTGAAGG - Intronic
907965721 1:59327071-59327093 ATTAGGGTGGTGGTTGCTGAAGG + Intronic
908036969 1:60066142-60066164 ATGAGGTTGGTAGTTGCTGTAGG + Intronic
908221309 1:62009528-62009550 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
908340649 1:63174898-63174920 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
908893032 1:68866928-68866950 ATTAGGGTGGTGGTAGGTGAAGG + Intergenic
909012701 1:70352709-70352731 ATAATGTTGTTTGTTGATGATGG - Intronic
909093776 1:71260889-71260911 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
909347157 1:74603879-74603901 ATCGGGGTGGTGGTTGCTGATGG + Intronic
909695862 1:78467056-78467078 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
909915989 1:81319850-81319872 ATCAGGATGGTAGTTGCTGAAGG + Intronic
910067970 1:83176443-83176465 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
910187710 1:84561689-84561711 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
910195510 1:84635755-84635777 AGTAGTTTGTTAGTTTCTGAGGG + Intergenic
910231558 1:84992878-84992900 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
910683620 1:89893082-89893104 TTTATGTTTTTGGTTGCTTATGG - Intronic
910732817 1:90417087-90417109 ATCAGGGTGGTGGTTGCTTAAGG - Intergenic
910912387 1:92250997-92251019 ATCAGATTGCTGGTTGCTGGAGG - Intronic
911178098 1:94837472-94837494 TTTAGGTTTTTGGTTTCTGTGGG + Intronic
911276859 1:95871054-95871076 AGTAGATTAGTGGTTGCTGAGGG - Intergenic
911408893 1:97477045-97477067 ATCAGGATGGTGGTTGCTGAAGG + Intronic
911649565 1:100372239-100372261 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
911755672 1:101551855-101551877 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
911896884 1:103447146-103447168 ATCAGGGTGGTGATTGCTGAAGG + Intergenic
911927861 1:103858903-103858925 ATGAGGGTGTTGGTTACTGAAGG + Intergenic
911955642 1:104231098-104231120 ATTAGAGTGGTGGTTACTGAAGG + Intergenic
911980865 1:104563900-104563922 ATTAGGGTAGTAGTTGCTGAAGG + Intergenic
912032904 1:105272279-105272301 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
913127003 1:115800623-115800645 ATCAGTGTGGTGGTTGCTGAAGG + Intergenic
913207166 1:116550126-116550148 ATCAGGGTGTTGGTTGCTAAAGG + Intronic
913308137 1:117453913-117453935 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
913310948 1:117492279-117492301 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
913344944 1:117799087-117799109 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
913679548 1:121176047-121176069 ATCAGGGTGGTGGTTGCTGGAGG - Intronic
914031381 1:143963693-143963715 ATCAGGGTGGTGGTTGCTGGAGG - Intronic
914158066 1:145104270-145104292 ATCAGGGTGGTGGTTGCTGGAGG + Intronic
914356796 1:146892763-146892785 ATCAGGGTGGTGGTTACTGAAGG + Intergenic
914415338 1:147475473-147475495 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
914960315 1:152199849-152199871 ATGAGGGTGGTGGTTGCTGAAGG + Intergenic
914977903 1:152382664-152382686 ATTAGGGTGATGGTCCCTGAAGG - Intergenic
915151471 1:153835505-153835527 ATTAGTGTGGTGGTTGCTGAAGG - Intronic
915600315 1:156919305-156919327 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
916623689 1:166530206-166530228 ATTAGGTTTTAGTTTGCTTAGGG + Intergenic
916778675 1:167998379-167998401 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
916831789 1:168500067-168500089 ATCAGGGTGGTGGTGGCTGAAGG + Intergenic
916847193 1:168663959-168663981 ATCAGGGTGGTGATTGCTGAAGG - Intergenic
916956754 1:169845360-169845382 ATCAGGATGGTGGTTGCTGAAGG + Intronic
917598808 1:176555540-176555562 TTGGGGTTGTTGGTTGTTGAAGG - Exonic
917669589 1:177260608-177260630 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
917719297 1:177770978-177771000 ATTAGACTGTTAGTTTCTGAGGG - Intergenic
918123781 1:181564083-181564105 ATTAGGGTGCTGGTTGCTAAAGG + Intronic
918392221 1:184078138-184078160 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
918568556 1:185959619-185959641 ATGATGATGTTGGTTGCTCATGG + Intronic
918606035 1:186427108-186427130 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
918975881 1:191485552-191485574 ATCAGGGTGGTGATTGCTGAAGG + Intergenic
919123329 1:193367536-193367558 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
919204033 1:194396973-194396995 ATTGGGACGGTGGTTGCTGAAGG + Intergenic
919281950 1:195501686-195501708 AACAGGGTGGTGGTTGCTGAAGG + Intergenic
919288162 1:195592752-195592774 ATTAGAGTGGTAGTTGCTGAAGG + Intergenic
919415404 1:197302163-197302185 ATCAGGGTGATGGTTGCTGAAGG - Intronic
919953791 1:202392439-202392461 AGTAGGTTGGTGGTTGCTTAGGG + Intronic
920466853 1:206194592-206194614 ATCAGGGTGGTGGTTGCTGGAGG - Intronic
920538172 1:206754675-206754697 ATTAAGGTGGTGGTTGCTGAAGG + Intergenic
920620057 1:207536712-207536734 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
920621839 1:207555267-207555289 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
920623465 1:207572362-207572384 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
920799840 1:209176165-209176187 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
921226134 1:213021590-213021612 ATCAGATTTGTGGTTGCTGAAGG - Intergenic
921276064 1:213521441-213521463 ATCAGGATGGTGATTGCTGATGG + Intergenic
921301874 1:213759117-213759139 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
921306804 1:213805181-213805203 ATCAGGCTGGTAGTTGCTGAGGG + Intergenic
921402457 1:214740883-214740905 ATGAGGATGGTGATTGCTGAAGG + Intergenic
921576306 1:216838922-216838944 ATTAGAGTGGTGGTTGCTGAAGG + Intronic
921829094 1:219707182-219707204 ATCAGGGTGGTGGTTGCAGAAGG - Intronic
922065360 1:222133353-222133375 ATCAGGATGGTGGTTGATGAAGG + Intergenic
922389416 1:225124219-225124241 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
922447854 1:225712609-225712631 AGTAGATTGTTGGTTGCTAGGGG - Intergenic
922588837 1:226757290-226757312 ATCAGGATGATTGTTGCTGAAGG - Intergenic
922651087 1:227338998-227339020 ACCAGGGTGATGGTTGCTGAAGG + Intergenic
923294254 1:232578044-232578066 ATCAGGGTGGTGGTGGCTGAAGG - Intergenic
923936023 1:238761275-238761297 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
924080816 1:240396012-240396034 ATTGGAATGGTGGTTGCTGAAGG - Intronic
924168738 1:241314300-241314322 ATGAGGGTGGTAGTTGCTGAAGG - Intronic
924499495 1:244623926-244623948 ATTGGGGTGGTGGTTGCTGATGG + Intronic
924929430 1:248714937-248714959 ATTAAGTTTTTGTTTGCTTAGGG + Intergenic
1062777076 10:160427-160449 ATTAGGGTGGTGGCTGCTGGAGG + Intronic
1062897355 10:1114370-1114392 ATAAGGGTGGTGGCTGCTGAAGG - Intronic
1063156390 10:3383226-3383248 AGTAGATTAGTGGTTGCTGAGGG + Intergenic
1063821477 10:9841509-9841531 ATCAGGTTTGTGGTTGCTAAAGG - Intergenic
1064225334 10:13478781-13478803 TTTATGTTGTTGGTGGCTTATGG + Intronic
1064837440 10:19549450-19549472 ATTAGGGTGGTGATTGCTGAAGG - Intronic
1064950082 10:20838735-20838757 ATCAGGATGGTGGCTGCTGAAGG - Intronic
1065899706 10:30195031-30195053 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1066056821 10:31689547-31689569 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
1066285296 10:33960240-33960262 ATCAGGGTGGCGGTTGCTGAAGG + Intergenic
1066399302 10:35059356-35059378 ATCATGGTGGTGGTTGCTGAAGG - Intronic
1066478841 10:35775314-35775336 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
1067186559 10:44033543-44033565 TTTAGGGTGGTGGTTGCTGAAGG + Intergenic
1067548305 10:47213247-47213269 ATCAGGTTGGTGGTTGCTGAAGG - Intergenic
1068127299 10:52856123-52856145 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1068482434 10:57609779-57609801 ATTAGGGTGATGGTTTCTGAAGG - Intergenic
1068532365 10:58203919-58203941 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
1068579928 10:58728068-58728090 ATCAGAATGATGGTTGCTGAAGG + Intronic
1068869936 10:61932344-61932366 ATCAGGGTCGTGGTTGCTGAAGG + Intronic
1069292253 10:66794603-66794625 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1069318888 10:67143043-67143065 ACCAGGATGGTGGTTGCTGAAGG + Intronic
1069411242 10:68155595-68155617 CTTAGGCTGTTGGTTACTAATGG - Intronic
1069666625 10:70165931-70165953 ATCAGGTTGATGATTGCTAAAGG - Intronic
1069736581 10:70659955-70659977 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1069937963 10:71931879-71931901 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1070180783 10:74011450-74011472 TTTAGACTGTTGGTTTCTGAAGG + Intronic
1070203946 10:74237002-74237024 ATCAGGATGTTGGTTGCTGAAGG + Intronic
1070360962 10:75688790-75688812 ATCAGGATGTTGGCTGCTGAAGG - Intronic
1070735046 10:78857492-78857514 AATAGATTGGTGGTTGCTCAGGG - Intergenic
1070944596 10:80378956-80378978 ATCAGGGTGGTAGTTGCTGAAGG + Intergenic
1071054140 10:81489532-81489554 ATTAGGGTGGTGGTTGCTGAAGG - Intergenic
1071132615 10:82412546-82412568 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1071226046 10:83528919-83528941 ATCAAGTTGTTGGTTGCGAAAGG + Intergenic
1071381685 10:85070224-85070246 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
1071399457 10:85255486-85255508 ATTAGATTGTGGGTTTCTTATGG + Intergenic
1071662834 10:87522709-87522731 ATGAGAGTGGTGGTTGCTGAAGG + Intronic
1071851521 10:89576046-89576068 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
1071871666 10:89801976-89801998 ATCAGGGTGGTGATTGCTGAAGG + Intergenic
1072094621 10:92165465-92165487 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
1072185042 10:93029062-93029084 ATTCGGGTGGTGATTGCTGAAGG - Intronic
1072325519 10:94294758-94294780 ATCAGGGGGGTGGTTGCTGAAGG + Intronic
1074004709 10:109409227-109409249 ATTAGATTAGTGGTTGCTTAGGG + Intergenic
1075168414 10:120090582-120090604 ACCAGGGTGATGGTTGCTGAAGG - Intergenic
1075225274 10:120623454-120623476 ATGAGGGTTCTGGTTGCTGAAGG - Intergenic
1075431664 10:122388787-122388809 ATTAGGATAGTGGTTGCTGAAGG + Intronic
1075596625 10:123735654-123735676 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1075750957 10:124770536-124770558 ATCAAGGTATTGGTTGCTGAAGG + Intronic
1075971056 10:126653152-126653174 ATCAGGGTGGTGTTTGCTGAAGG + Intronic
1076050124 10:127326140-127326162 ATCAGGATGGTGGTTGCTGAGGG + Intronic
1076095214 10:127728928-127728950 ATCAGGGTGGTGGTTGCTAAAGG + Intergenic
1076172567 10:128334352-128334374 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
1076513686 10:131030937-131030959 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
1076549032 10:131265835-131265857 ATCAGGATGGTGGTTGCTGAAGG + Intronic
1076992342 11:282040-282062 CATAGGTTGTGGGTGGCTGACGG - Intronic
1077039623 11:513864-513886 ATCAGGGTGGTGGTGGCTGAAGG - Intergenic
1077347161 11:2067117-2067139 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1077616658 11:3680123-3680145 ATCAGGGTGTTGCCTGCTGAAGG + Intronic
1077755353 11:5023008-5023030 AACAGGATGGTGGTTGCTGAAGG + Intergenic
1077946015 11:6899373-6899395 ATTAAGTATTTGGTTTCTGAAGG + Intergenic
1078805328 11:14694430-14694452 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1079184529 11:18224593-18224615 AGGAGGTGGTTGGTTGCTGAAGG - Intronic
1079303558 11:19301702-19301724 ATCAGGGTGGTGGTTGCTGTAGG + Intergenic
1080064563 11:27995967-27995989 ATTAGGGTGGTAGTTGCTGAAGG - Intergenic
1080143876 11:28955892-28955914 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
1080272886 11:30469413-30469435 ATTAGGTTGTTTGCTGCTATGGG - Intronic
1080544283 11:33300381-33300403 ATCAGGATGGTGGTTGCTGAAGG - Intronic
1080902082 11:36504136-36504158 ATCAGGTTGGTGGCTGCTGATGG + Intronic
1080940152 11:36907533-36907555 GTCAGGGTGGTGGTTGCTGAAGG - Intergenic
1081030585 11:38076647-38076669 ACTAGTCTGTTGGTTGCTGAGGG - Intergenic
1081086482 11:38808375-38808397 ATCAGGGTGGTGCTTGCTGAAGG - Intergenic
1081094235 11:38912199-38912221 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1081416808 11:42825393-42825415 AATTGTTTGTTGGTTCCTGAAGG - Intergenic
1082662625 11:55931513-55931535 ATCAGGGTGATGGTGGCTGAAGG + Intergenic
1082922865 11:58514615-58514637 ATCAGGATGATGCTTGCTGAAGG + Intergenic
1083071320 11:59985801-59985823 ATTAGAGTGGTGGTTGCTGAAGG + Intergenic
1083135315 11:60668913-60668935 ATTAGGGTGGTGTTTACTGAAGG - Intergenic
1083247044 11:61436764-61436786 ATTGGTTTGTTTGTTGCTGTTGG + Intronic
1083577307 11:63801414-63801436 AGTAGGTTAGTGGTTGCTTAGGG + Intergenic
1083717813 11:64588571-64588593 ATTAGACTGTTGGCTTCTGATGG + Intergenic
1084505009 11:69560253-69560275 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1084739132 11:71127512-71127534 ATCAGAGTGGTGGTTGCTGAAGG - Intronic
1084761824 11:71277965-71277987 ATTAGGGTGGTGGTTGCTGAAGG - Intergenic
1085290110 11:75392087-75392109 ATCAGGGTGGTGGTTGTTGAAGG - Intergenic
1085373094 11:76029899-76029921 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1085529899 11:77185185-77185207 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
1085616896 11:78007127-78007149 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1085858261 11:80200677-80200699 ATCAAGATGGTGGTTGCTGAAGG - Intergenic
1086007544 11:82055893-82055915 ATCAGGGTGATAGTTGCTGAAGG - Intergenic
1086081833 11:82911155-82911177 CTTGGGGTGGTGGTTGCTGAAGG + Intronic
1086121410 11:83308304-83308326 ATCAGCGTGGTGGTTGCTGAAGG + Intergenic
1086318738 11:85622030-85622052 ATCAGGGTGATGATTGCTGAAGG - Intronic
1086323425 11:85673594-85673616 ATTAAGGTAGTGGTTGCTGAAGG + Intronic
1086733851 11:90282330-90282352 ATCAGGGTGGTGATTGCTGAAGG + Intergenic
1086774923 11:90818741-90818763 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
1086778445 11:90870500-90870522 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1087023458 11:93626380-93626402 ATCAGGGTGGTAGTTGCTGAAGG + Intergenic
1087358350 11:97123915-97123937 ATTATGCTGTTGATTGTTGAGGG - Intergenic
1087608699 11:100408301-100408323 AACAGGATGGTGGTTGCTGAAGG + Intergenic
1087644974 11:100798400-100798422 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1087650860 11:100865861-100865883 ATAAGGGTGGTGGTTGCTGAAGG + Intronic
1088157049 11:106819465-106819487 ATCAGGGTAGTGGTTGCTGAAGG - Intronic
1088389253 11:109296019-109296041 ATCAGGATGGTAGTTGCTGAAGG + Intergenic
1088463018 11:110102788-110102810 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1088518602 11:110668212-110668234 ATAAGGATGGTGGTTGCCGAAGG - Intronic
1088856140 11:113755774-113755796 ATCAGGATGGTGGTTGCTGAAGG - Intronic
1088974637 11:114804912-114804934 ATTAGATTCATGGATGCTGAAGG + Intergenic
1089415554 11:118286654-118286676 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1090260693 11:125316788-125316810 ATTAGGAGTTTAGTTGCTGAAGG + Intronic
1090737928 11:129627875-129627897 ATCAGAGTGGTGGTTGCTGAAGG + Intergenic
1090877265 11:130801831-130801853 CTGAGGTTATTGCTTGCTGAGGG - Intergenic
1091093776 11:132797858-132797880 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1091515382 12:1175180-1175202 ATCAGGGTGGTAGTTGCTGAAGG + Intronic
1091869639 12:3877676-3877698 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
1092131519 12:6116549-6116571 AGCAGGCTGTTGGTTGTTGATGG + Intronic
1092464810 12:8721225-8721247 GTCAGGGTGGTGGTTGCTGAAGG + Intronic
1092549746 12:9485420-9485442 ATAAGGGTATTGGTTGATGAAGG + Intergenic
1092599784 12:10047882-10047904 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
1092622777 12:10291246-10291268 ATCAGGGTGGTGGTTGTTGAAGG + Intergenic
1092623457 12:10299661-10299683 ACTGGGGTGGTGGTTGCTGAAGG + Intergenic
1092648326 12:10604313-10604335 ATTTGATTGTAAGTTGCTGATGG - Exonic
1093375203 12:18417524-18417546 ATCAGGATGGTGGTTGCTGAAGG - Intronic
1093450779 12:19310977-19310999 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1093541343 12:20289421-20289443 ATTGGGGTGGTGGTTGCTAAAGG - Intergenic
1093635038 12:21456639-21456661 ATCAGGGTGGTGCTTGCTGAAGG + Intronic
1093658501 12:21725469-21725491 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
1094250304 12:28352243-28352265 ATAAGGGTGGTGGTTGCTGAAGG + Intronic
1094465367 12:30748319-30748341 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1094632765 12:32193213-32193235 ATCAGGTTGGTGGTTGTTGAAGG - Intronic
1094763874 12:33569091-33569113 ATGAGGTTGTCAGTGGCTGAGGG - Intergenic
1095040400 12:37434625-37434647 ATCAGGGTGATGGTTGCTGAGGG - Intergenic
1095168881 12:39009445-39009467 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
1095233200 12:39766498-39766520 ATTAGGGTAGTAGTTGCTGAAGG + Intronic
1095763968 12:45873868-45873890 ATCAGGATAGTGGTTGCTGAAGG + Intronic
1095912030 12:47437419-47437441 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1096238508 12:49945840-49945862 ATTAGGGTGTTGTTTGCTGCTGG - Intergenic
1096432000 12:51552951-51552973 ATGAGGGTGATGGTTGTTGAAGG + Intergenic
1097252713 12:57646460-57646482 ATTAAGTTTTGGTTTGCTGAGGG + Intergenic
1097642149 12:62195050-62195072 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
1097659388 12:62412312-62412334 ACCAGGATGGTGGTTGCTGAAGG + Intronic
1097788336 12:63786655-63786677 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1098075043 12:66720381-66720403 ATTAGGGTGGTGACTGCTGAAGG + Intronic
1098263075 12:68691292-68691314 ATGCTGTGGTTGGTTGCTGATGG + Intronic
1098427136 12:70377539-70377561 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1098575672 12:72039036-72039058 ATCAGGGTGGTGGTTACTGAAGG + Intronic
1099003394 12:77207926-77207948 ATCAGGGTGATGGTTGCTGAAGG + Intergenic
1099252650 12:80275733-80275755 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1099410903 12:82325960-82325982 ATTAAGGTGGTGGTTGCTAACGG + Intronic
1099461535 12:82927707-82927729 GTAAGGGTGATGGTTGCTGAAGG - Intronic
1099592723 12:84616364-84616386 ATTAGGATTGTGGTTGCTGAAGG - Intergenic
1099609220 12:84845319-84845341 AGCAGGGTGGTGGTTGCTGAAGG - Intergenic
1099789623 12:87316253-87316275 AACAGGGTGATGGTTGCTGAAGG - Intergenic
1100169373 12:91956721-91956743 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1100190195 12:92182083-92182105 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1100516061 12:95329045-95329067 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1100962103 12:99974098-99974120 ATTAGAATGGTGGTTGCTGAAGG - Intronic
1101149450 12:101871106-101871128 CTTAGGGTGGTGGTTGCTGAAGG - Intergenic
1101562278 12:105868850-105868872 ATCAGGTTGGTGGCTGCTGAAGG - Intergenic
1101620365 12:106381146-106381168 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
1101685266 12:107013253-107013275 ATCAGGGTAGTGGTTGCTGATGG - Intronic
1101887144 12:108675075-108675097 ATGAGGGTGGTGGTTGCTGAAGG - Intronic
1102876131 12:116450429-116450451 ATTAGATTAATGGTTGCTGGGGG - Intergenic
1104395924 12:128432934-128432956 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1105020412 12:132812815-132812837 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1105998449 13:25695355-25695377 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
1106149127 13:27080969-27080991 ATCAGGATGGTGGTTGCTGAAGG + Intronic
1106497880 13:30297261-30297283 ATCAGGGTAGTGGTTGCTGAAGG - Intronic
1106707151 13:32292878-32292900 ATCAGGATGGTGGTGGCTGAAGG - Intronic
1106725278 13:32478033-32478055 ATTAGTCTGCTGGTTGCTGTGGG + Intronic
1106946776 13:34837052-34837074 ATGATGTTGATGGCTGCTGATGG - Intergenic
1107312160 13:39090799-39090821 ATTATTTTGTTTGTTCCTGACGG + Intergenic
1108331006 13:49383957-49383979 ATCAGGTTGTTGGCTGCTGAAGG + Intronic
1108801547 13:54102293-54102315 ATTGGAATGGTGGTTGCTGAAGG + Intergenic
1108844875 13:54665892-54665914 ATCAGGATGGTGATTGCTGAAGG + Intergenic
1108962847 13:56258073-56258095 ATTAAGGTGGTGGTTGCTGAAGG - Intergenic
1109080629 13:57895554-57895576 ATCAGGGTGATGGGTGCTGAAGG - Intergenic
1109822236 13:67672132-67672154 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
1109984965 13:69968117-69968139 ATCAGGGTGGTGGTTGCAGAAGG - Intronic
1110226744 13:73127779-73127801 ATCAGGGTGCTGGTTGCTTAAGG - Intergenic
1110288898 13:73781055-73781077 ATCAGTGTGGTGGTTGCTGAAGG - Intronic
1110521719 13:76487154-76487176 GTCAGGGTGGTGGTTGCTGAAGG - Intergenic
1110640231 13:77815297-77815319 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1110672007 13:78191510-78191532 ATGAGGTGGCTGGTAGCTGAGGG - Intergenic
1110746424 13:79058938-79058960 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1110829662 13:80016313-80016335 ATCAGGATAGTGGTTGCTGAAGG - Intergenic
1110995704 13:82106406-82106428 TTGAGGTTGATGGCTGCTGATGG + Intergenic
1111080003 13:83292866-83292888 ATAAGGATGGTGGTTGCTGAAGG + Intergenic
1111155901 13:84324957-84324979 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1111211418 13:85084585-85084607 ATTAGGGTGGTGGTTGCTAAAGG + Intergenic
1111384309 13:87503900-87503922 ATCAGCATGGTGGTTGCTGAAGG + Intergenic
1111571616 13:90094957-90094979 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1112116080 13:96355711-96355733 ATCAGGGTGGTGGTTACTGAAGG + Intronic
1112279742 13:98052042-98052064 ATTAGGGTGGTGGTTGCTGAAGG - Intergenic
1112544002 13:100346773-100346795 ATCAGGCTGATGGATGCTGAAGG - Intronic
1113304180 13:109058679-109058701 ATCAGGCTGATGGTTGCTGAAGG + Intronic
1113712910 13:112481862-112481884 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1114442714 14:22763594-22763616 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
1115060488 14:29182912-29182934 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1115154836 14:30326482-30326504 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1115202022 14:30863934-30863956 AGGAGGTTTTTGGTTGATGATGG - Intergenic
1115468472 14:33742605-33742627 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1115670186 14:35601993-35602015 AGTAGGTTAATGGTTGCTTAGGG - Intronic
1115891379 14:38033435-38033457 AGTAGGGTGGTGGTTACTGAAGG + Intronic
1116101113 14:40437761-40437783 CTTAGGATGGTGGTTGCTAAAGG + Intergenic
1116141869 14:41006205-41006227 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
1116277177 14:42850310-42850332 ATTAGGATGGTGGTTGCTGAGGG + Intergenic
1116476023 14:45340487-45340509 ATCAGAATGGTGGTTGCTGAAGG + Intergenic
1116592236 14:46792588-46792610 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
1116828539 14:49694992-49695014 ATTAGGGTGGTTGTTGCTGAAGG + Intronic
1117519709 14:56538964-56538986 ATCAGGGTGGTGGTTGCTAAAGG - Intronic
1117926651 14:60787462-60787484 ATCAGGATGGTGATTGCTGAAGG + Intronic
1118116907 14:62788669-62788691 ATCAGATTGGTGGTTGCTGAAGG - Intronic
1118518212 14:66550723-66550745 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
1118803298 14:69210995-69211017 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
1118854117 14:69608129-69608151 AGTAGATTGTTGGTTGCCTAGGG + Intergenic
1119048939 14:71346874-71346896 AGTAGGTTAGTGGTTGCTTAGGG - Intronic
1119145260 14:72307060-72307082 ATGAGGATAATGGTTGCTGAAGG - Intronic
1119170693 14:72534129-72534151 ATTAGGGTGGTGATTGCCGAAGG - Intronic
1119308748 14:73629102-73629124 ACTAGGGTGGTGGTTGCAGAAGG - Intergenic
1119883133 14:78117430-78117452 ATCAGGGTGTTGGTTGCTGAAGG + Intergenic
1119964116 14:78894076-78894098 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
1119978128 14:79048690-79048712 ATCAGGGTGGTGGCTGCTGAAGG + Intronic
1120368675 14:83604596-83604618 ATGAAGTTTTTGGTTGCTGCTGG + Intergenic
1121252254 14:92508066-92508088 ATCAGGGTGGTGGTTGCTAAAGG + Intergenic
1121373549 14:93383651-93383673 ATCAGGGTGGTGGTTGCAGAAGG + Intronic
1121704992 14:95985204-95985226 ATCAGGGTGACGGTTGCTGATGG + Intergenic
1121766418 14:96490536-96490558 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1121910516 14:97787084-97787106 ATTAAGGTGTTGGTTGCTGAAGG - Intergenic
1122324382 14:100874000-100874022 AGTAGATTTTTGGTTGCTGAGGG - Intergenic
1122557091 14:102586570-102586592 AGCAGATTATTGGTTGCTGAGGG - Intergenic
1122662314 14:103305297-103305319 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1123013399 14:105360648-105360670 GTCAGAGTGTTGGTTGCTGAAGG + Intronic
1124461166 15:29893549-29893571 ATCAGGGTGGTGCTTGCTGAAGG - Intronic
1124560339 15:30767611-30767633 ATCAGGGTGGTGATTGCTGAAGG + Intronic
1124669660 15:31627044-31627066 ATCAGGCTGGTAGTTGCTGAAGG + Intronic
1124670903 15:31638173-31638195 ATCAGGGTGGTGATTGCTGAAGG - Intronic
1124709128 15:31990761-31990783 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1125109075 15:36009669-36009691 ACCAGGATGGTGGTTGCTGAAGG + Intergenic
1125236574 15:37521603-37521625 ATGAGGGTGGTGGTTGCTGAAGG + Intergenic
1125906631 15:43398809-43398831 ATAATGTTGCTGGTTACTGAAGG - Intronic
1126541199 15:49826073-49826095 ATCAGGGTGGTGGTCGCTGAAGG + Intergenic
1127104580 15:55599401-55599423 CTTTGGTTATTGGTTGCAGAGGG - Intergenic
1127788946 15:62381175-62381197 ACTGGGGTGTTGGTGGCTGATGG - Intergenic
1128722717 15:69963332-69963354 ATGAGGGTGGTGGTGGCTGAAGG - Intergenic
1128848803 15:70929516-70929538 ATCAAGGTGATGGTTGCTGAAGG + Intronic
1129575258 15:76736317-76736339 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1130290300 15:82593097-82593119 ATAAGGGTGGTGGTTGCTGAAGG + Intronic
1130325900 15:82879693-82879715 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1131652843 15:94420992-94421014 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1131887225 15:96929219-96929241 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1131898763 15:97064682-97064704 ATCAGGGTAGTGGTTGCTGAAGG - Intergenic
1133531817 16:6662102-6662124 AGTAGGATGGTGGTTGCCGAGGG + Intronic
1135377312 16:21959104-21959126 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
1135746918 16:25025167-25025189 ATACGGTGGTTGGTTGCTGGAGG - Intergenic
1135755873 16:25097604-25097626 ATAAAGTGGTTGGTTGCTGGAGG - Intergenic
1136647982 16:31639669-31639691 ATCAGGGTGGTTGTTGCTGAAGG + Intergenic
1137465993 16:48710223-48710245 ATTTGGGTGGTGGTTGCTGCAGG - Intergenic
1138073143 16:54013632-54013654 ATTGGGGTGGTGGTTGTTGAAGG - Intronic
1138246760 16:55472684-55472706 ATCAGGGTGGTGGCTGCTGAAGG + Intronic
1138255298 16:55552841-55552863 ATCAGGATGGTAGTTGCTGAAGG + Intronic
1139002797 16:62534180-62534202 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1139126109 16:64079529-64079551 ATCAGGGTGGTGGTCGCTGAAGG - Intergenic
1139803830 16:69546722-69546744 ATTAGGGTGGTGGTTGCTGAAGG - Intergenic
1139977218 16:70822690-70822712 ATGAGGGTGGTGGTTACTGAAGG - Intronic
1140156963 16:72440177-72440199 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1140492916 16:75355203-75355225 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
1140595726 16:76407953-76407975 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1140839411 16:78825302-78825324 AAGAGGATGTTGGTCGCTGATGG + Intronic
1140872127 16:79116195-79116217 ATCAAGTTGGCGGTTGCTGAAGG + Intronic
1141292183 16:82728663-82728685 ATCAGGGTGGGGGTTGCTGAAGG + Intronic
1141349465 16:83280040-83280062 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1141776904 16:86129388-86129410 ATCAGGGTGGTGCTTGCTGAAGG + Intergenic
1141903608 16:87008420-87008442 ATTAGATTGCTGGTGGCTGGGGG + Intergenic
1142587803 17:985310-985332 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1142653082 17:1369983-1370005 CTTAGGGTGATGGCTGCTGAAGG + Intronic
1143753279 17:9047173-9047195 ATCAGGGTGGTGGTTGCTAAAGG + Intronic
1144707037 17:17376219-17376241 ATCAGGGTGGTGATTGCTGAAGG - Intergenic
1145377431 17:22363721-22363743 ATCGGGGTGGTGGTTGCTGAGGG + Intergenic
1146042658 17:29471685-29471707 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
1146106436 17:30041777-30041799 ATTAGGGTTGTGGTTGCTGAAGG - Intronic
1146210161 17:30936077-30936099 AGTAAGTTGTTGGTTGCCTAGGG - Intronic
1146359984 17:32166384-32166406 ATTAGGGTGGTGATTCCTGAAGG + Intronic
1146412491 17:32598995-32599017 ATCAGGGTGGTGGTTGCTGATGG + Intronic
1146838377 17:36131239-36131261 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
1147231341 17:39020900-39020922 ATTAGGGTAGTGGTTGCTGAAGG - Intergenic
1147680434 17:42240459-42240481 AATAGATTGTTGGTTGCCAAGGG + Intronic
1148660039 17:49322994-49323016 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1148692350 17:49536649-49536671 GTCAGGATGGTGGTTGCTGAAGG + Intergenic
1149299549 17:55292334-55292356 ATCAGGGTGGTGTTTGCTGAAGG - Intronic
1149377084 17:56055011-56055033 ATCAGGGTGGTGGTTGTTGAAGG + Intergenic
1149390387 17:56184264-56184286 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1149518271 17:57297539-57297561 ATCAGGGTGGTGGTTGCAGAAGG + Intronic
1149726547 17:58900355-58900377 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
1149809241 17:59651777-59651799 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
1150198997 17:63333784-63333806 ATTAGGGTGGTGATTGCTGAAGG - Intronic
1150509219 17:65731502-65731524 ATAAGGGTGGTGGTTGCTGAAGG + Intronic
1150662424 17:67094917-67094939 ACCAGGGTGGTGGTTGCTGAAGG + Intronic
1150833709 17:68545568-68545590 ACTGGGGTGGTGGTTGCTGAAGG + Intronic
1152402564 17:80076615-80076637 ATGAGGGTGGTGGTTGCTGAAGG - Intronic
1153270439 18:3315689-3315711 ATTAGGGAGGTGGTTGCTGAAGG + Intergenic
1153352785 18:4099644-4099666 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1153570018 18:6461441-6461463 ATCAAGTTGGTGGTTGCTAAAGG - Intergenic
1153833947 18:8947784-8947806 ATTTGGTTCTTTGTGGCTGAAGG - Intergenic
1153877719 18:9390112-9390134 ATCAGGCTGGTGGTTGCTGAAGG + Intronic
1154347953 18:13559295-13559317 ATTTGTTTGTTTGTTGGTGAGGG - Intronic
1154398711 18:14014286-14014308 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1155102237 18:22622995-22623017 GTCAGGGTGGTGGTTGCTGAAGG - Intergenic
1155265975 18:24093886-24093908 ATCAGGATGGTGGTTGCTGAAGG + Intronic
1155470219 18:26183895-26183917 ATCAGGGTAGTGGTTGCTGAAGG - Intronic
1155686430 18:28557526-28557548 ATTATGGTAGTGGTTGCTGAAGG - Intergenic
1155741390 18:29292447-29292469 ATCAGGATGGTAGTTGCTGAAGG - Intergenic
1156085727 18:33399298-33399320 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
1156102495 18:33614019-33614041 ATCAGGATAGTGGTTGCTGAAGG + Intronic
1156128123 18:33933344-33933366 ATTAAGGTGATGGTTGTTGAAGG + Intronic
1156321118 18:36023699-36023721 ATTAGGGTGGTGATTGCTGAAGG - Intronic
1156843905 18:41640816-41640838 ATAAGGATGATGTTTGCTGAAGG - Intergenic
1156875798 18:42009917-42009939 ATCAGGGTGATGGTTGCAGAAGG + Intronic
1156880831 18:42077253-42077275 ATCAGGGTGGTGGTTGCTAAAGG + Intronic
1157020098 18:43771172-43771194 ATTAGGGTGGTGTTTGCTGGAGG - Intergenic
1157722723 18:49937787-49937809 AGTAGGTTATTGGTTGCTAGGGG + Intronic
1157873827 18:51253698-51253720 CTTGGGTTGTTGATTGTTGAAGG + Intergenic
1158211934 18:55060827-55060849 ATTAGGGTGATGGTTGCTGAAGG + Intergenic
1158571870 18:58603210-58603232 ATTAGGTTGTTGGATTATTACGG - Intronic
1158757435 18:60343359-60343381 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1158913108 18:62087831-62087853 AGTAGAATGATGGTTGCTGAGGG + Intronic
1159656993 18:71042029-71042051 ATTAGGGTAGTGGTTGCTGAAGG - Intergenic
1162394897 19:10411856-10411878 ATGAGGGTGGTGGTTGCTGAAGG + Intronic
1164490069 19:28702190-28702212 ATCAGGATAGTGGTTGCTGAAGG + Intergenic
1164901068 19:31924254-31924276 ATCAGGGTGGTGGATGCTGAAGG + Intergenic
1165221423 19:34319858-34319880 TTTAGGTTGTGGGTTGCTGTTGG - Intronic
1165262898 19:34636111-34636133 TTCAGGTTGTTGGTTTCTAATGG - Intronic
1165599184 19:37038326-37038348 ATTGGGGTGGTGGTTGCTGAAGG + Intronic
1166314207 19:41979661-41979683 AGTAGGTTAGTGGTTGCTTAGGG + Intronic
1166622243 19:44311749-44311771 ATCAGGGTGGTAGTTGCTGAAGG + Intergenic
1167017790 19:46852423-46852445 ATTAGGTAGTGAGTTGTTGAGGG + Intergenic
925168383 2:1734387-1734409 TTTATGTTGCTGGCTGCTGACGG + Intronic
925168388 2:1734410-1734432 ATCAGGGTGGTGGCTGCTGAAGG + Intronic
925299675 2:2802051-2802073 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
925508035 2:4591355-4591377 ATCAGGGTGGTTGTTGCTGAAGG - Intergenic
925871299 2:8273254-8273276 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
926450105 2:12992960-12992982 TTTAGGATGATGGTTGTTGAAGG - Intergenic
926608288 2:14919430-14919452 ATTAGGGTGGTAGTTGCTAAAGG + Intergenic
926649408 2:15325470-15325492 ATCAGGATTGTGGTTGCTGAGGG + Intronic
926841608 2:17087184-17087206 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
926979326 2:18550675-18550697 TTCAGGGTGGTGGTTGCTGAAGG - Intergenic
927105809 2:19823927-19823949 ATTAGGGTGGTGGTTGTTGAAGG + Intergenic
927322308 2:21761708-21761730 ATCAGGGTAATGGTTGCTGAAGG + Intergenic
927324489 2:21788221-21788243 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
928025281 2:27734427-27734449 AGTAGGTTAGTGGTTGCTTAGGG - Intergenic
928720205 2:34112001-34112023 ATTAGGGTGGTGGTTGCTGAAGG - Intergenic
928726706 2:34182473-34182495 ATCAGGGTGGTGGTTGATGAAGG - Intergenic
928916007 2:36471432-36471454 ATAAGGATGGTGGTTGCTGAAGG - Intronic
929097307 2:38275815-38275837 ATCAGGGTGGTGGTTGCAGAAGG + Intergenic
929323322 2:40573542-40573564 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
929339550 2:40797873-40797895 ATCAGGGTGGTGGTTGCAGAAGG - Intergenic
929554224 2:42915253-42915275 TTTAGGTTGTTGATTGATTAGGG - Intergenic
929757963 2:44783744-44783766 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
929939047 2:46316693-46316715 ATTAGTGTGACGGTTGCTGAAGG + Intronic
930322017 2:49867354-49867376 ATCAGGGTGTTGGCTGCTGAAGG + Intergenic
930351265 2:50258099-50258121 ATTAGGGTGGTGGCTGCTGAAGG + Intronic
930504839 2:52270102-52270124 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
930831750 2:55751148-55751170 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
931498135 2:62834409-62834431 ATTAGGGTGGTGGTTGCTGAAGG - Intronic
932116896 2:69059338-69059360 ATCAGAGTGATGGTTGCTGAAGG - Intronic
932185984 2:69696004-69696026 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
932286595 2:70538982-70539004 ATCAGGGTTGTGGTTGCTGAAGG - Intronic
932469777 2:71946382-71946404 ATGAGGGTGGTGGTTGCTGAAGG + Intergenic
932504119 2:72212246-72212268 ATCAGGCTGTTGGTAGCTGGTGG - Intronic
932862583 2:75310049-75310071 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
933328270 2:80865508-80865530 ATTAGGGTGGTGGTTGCTGGAGG + Intergenic
934548479 2:95239525-95239547 ATCAGGTCGGTGGTTTCTGAAGG - Intronic
934869909 2:97854136-97854158 ATCAGGGTAGTGGTTGCTGAAGG - Intronic
934880873 2:97977747-97977769 ATCAGGATAATGGTTGCTGAAGG + Intronic
935484086 2:103631305-103631327 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
935796774 2:106649685-106649707 ATCAGGGTGTTGGTTGCTGAAGG + Intergenic
936686040 2:114827486-114827508 ATTAAGTAGTTGGTGGCTTATGG - Intronic
937678213 2:124615132-124615154 ATTAGGATGGTGGTTGCTGAAGG + Intronic
937832713 2:126441240-126441262 ATCAGGGTGGTGGTTACTGAAGG + Intergenic
938613950 2:132978490-132978512 ATGAGGTGGTTGGATGCTGGAGG + Intronic
938871843 2:135486075-135486097 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
938876779 2:135539848-135539870 ATCAAGATGGTGGTTGCTGAAGG + Intronic
938960848 2:136340255-136340277 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
938987104 2:136587391-136587413 ATCAGGGTGGTAGTTGCTGAAGG + Intergenic
939652653 2:144784302-144784324 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
939663792 2:144924231-144924253 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
939704661 2:145437566-145437588 ATCAGGTTGGTGGTTGCTGGAGG + Intergenic
939722584 2:145673472-145673494 ATTGGAGTGGTGGTTGCTGAAGG + Intergenic
940024101 2:149186939-149186961 ATCAGGGTGGTGGTTGCTAAAGG - Intronic
940049261 2:149444360-149444382 ATCAGGGTGATGGTTGCTGAAGG + Intronic
940199151 2:151130796-151130818 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
940480260 2:154219912-154219934 ATTAGGTTGCTCCCTGCTGAGGG - Intronic
940536668 2:154954340-154954362 ATTAGACTGGGGGTTGCTGAAGG + Intergenic
940756415 2:157688125-157688147 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
940880533 2:158942610-158942632 ATTAAAATGGTGGTTGCTGAAGG - Intergenic
941077698 2:161024690-161024712 ATCAGGGTGATGGTTGCTGAAGG - Intergenic
941177723 2:162220035-162220057 ATTAGGTTTGTGGGTGCAGAGGG - Intronic
941488450 2:166112242-166112264 ATCAGGGTGGTAGTTGCTGAAGG - Intronic
942258764 2:174136129-174136151 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
942631361 2:177953185-177953207 ATTTGTTTGTTTGTTTCTGATGG - Intronic
942793277 2:179786026-179786048 ATCAGGGTGGTGCTTGCTGAAGG - Intronic
942833076 2:180259970-180259992 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
942877098 2:180814006-180814028 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
943087693 2:183332950-183332972 ATCAGGATGGTGGTTACTGAAGG - Intergenic
943246889 2:185465643-185465665 ATTAGGGTGGTGATTGCTGAAGG + Intergenic
943457080 2:188121457-188121479 ATCAGGGTGCTGGTTGCTGAAGG - Intergenic
943616416 2:190097394-190097416 ATCAGGGTGGTAGTTGCTGATGG + Intronic
943740696 2:191404887-191404909 ATGAGGGTGGTGGCTGCTGAAGG + Intronic
943812364 2:192203828-192203850 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
943851062 2:192723622-192723644 ATAAGAGTGGTGGTTGCTGAAGG + Intergenic
943860198 2:192851849-192851871 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
943872538 2:193019642-193019664 ATCAGCATGGTGGTTGCTGAAGG - Intergenic
943941037 2:193997096-193997118 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
944003715 2:194876023-194876045 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
944010757 2:194972013-194972035 CTCGGGTTGGTGGTTGCTGATGG - Intergenic
944138323 2:196426003-196426025 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
944247421 2:197545745-197545767 ATTAGGTTGGTTGTTGCTTAGGG + Intronic
944256084 2:197624994-197625016 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
944274092 2:197816172-197816194 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
944338616 2:198568055-198568077 AGCAGGGTGGTGGTTGCTGAAGG - Intronic
944750286 2:202702456-202702478 ATCAGGGTGATGGCTGCTGAAGG - Intronic
945383754 2:209172697-209172719 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
945413490 2:209541410-209541432 ATCAGGGTGGTGGTTTCTGAAGG + Intronic
945487127 2:210409301-210409323 ATCAGTGTGGTGGTTGCTGAAGG + Intergenic
945646917 2:212508015-212508037 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
945651991 2:212573926-212573948 ATTAGGCTGCTGATTACTGAAGG + Intergenic
945690800 2:213032823-213032845 ATAAGGCTGGTGGTTGTTGAAGG + Intronic
945989695 2:216384914-216384936 ATCAGGCTGGTGGTTGTTGAAGG - Intergenic
946264979 2:218532515-218532537 ATTAGGGTGGTGGTTGCTGAAGG - Intronic
946464469 2:219899112-219899134 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
946747260 2:222858907-222858929 ATCAAGGTGATGGTTGCTGAAGG - Intergenic
947020602 2:225671044-225671066 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
947050530 2:226037951-226037973 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
947411564 2:229846315-229846337 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
947654444 2:231814263-231814285 GTCAGGGTGGTGGTTGCTGAAGG + Intergenic
947786536 2:232826881-232826903 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
947964364 2:234267155-234267177 ATGAGCTTGTGGGTTGCTGGAGG + Intergenic
949006565 2:241652729-241652751 ATTGGGTTGTTGGTGGGTGACGG + Intronic
1169159500 20:3364826-3364848 ATCAGGGTGTTGGCTGCTGAAGG + Intronic
1169432973 20:5556014-5556036 ATTAGGGTGGTGGTTGCTGAAGG - Intronic
1169485336 20:6026192-6026214 ATCAGTGTGGTGGTTGCTGAAGG - Intronic
1169518333 20:6342965-6342987 ATCAGGGTGATGGTTGATGAAGG + Intergenic
1169654012 20:7902332-7902354 ATCAGGGTAGTGGTTGCTGAAGG - Intronic
1169750597 20:8989180-8989202 ATCAGGGCGGTGGTTGCTGAAGG + Intergenic
1169756381 20:9047379-9047401 ATCAGGTTGGTAGTTGCTGAAGG + Intergenic
1170215368 20:13885556-13885578 ATTGGGTAATTGGTTGCTGCTGG + Intronic
1170246815 20:14230132-14230154 ATCAGGGTGATGGTTGCTGAAGG + Intronic
1170682355 20:18537889-18537911 ATCAGGTTAGTAGTTGCTGAAGG + Intronic
1170753462 20:19173553-19173575 ATAAAGATGGTGGTTGCTGAAGG + Intergenic
1171205637 20:23278527-23278549 GTCAGGGTGGTGGTTGCTGAAGG - Intergenic
1171228458 20:23461075-23461097 ATCAGACTGGTGGTTGCTGAAGG - Intergenic
1171313306 20:24164236-24164258 ATCAGGGTGGTGGGTGCTGAAGG - Intergenic
1171323691 20:24270841-24270863 ATGAGGGTGGTGGTTGCTGAAGG + Intergenic
1171526062 20:25812373-25812395 ATCCGGGTGGTGGTTGCTGAGGG - Intronic
1171534971 20:25879303-25879325 ATCAGGGTGATAGTTGCTGAGGG - Intergenic
1171550765 20:26043512-26043534 ATCCGGGTGGTGGTTGCTGAGGG + Intergenic
1171572916 20:26270655-26270677 ATCAGAGTGATGGTTGCTGAGGG + Intergenic
1171806103 20:29681635-29681657 ATCAGGGTGATGGTTGCTGAGGG + Intergenic
1171837956 20:30174786-30174808 ATCAGGGTGATGGTTGCTGAGGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172745265 20:37202865-37202887 CATAGATTGCTGGTTGCTGAGGG + Intronic
1172818118 20:37706191-37706213 ATTAGGGTGGTGTTTGCTGAAGG + Intronic
1173106993 20:40146159-40146181 ATCAGGGTGATGGTTGCTGAAGG + Intergenic
1173766573 20:45615999-45616021 ATCAGGGTGGTGGTTGCTGAGGG + Intronic
1173941854 20:46917853-46917875 ATCAGGGCGGTGGTTGCTGAAGG + Intronic
1174608259 20:51777250-51777272 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1174652843 20:52142937-52142959 ATCAGGGTTGTGGTTGCTGAAGG - Intronic
1174673332 20:52329287-52329309 ATTAGGGTGATAGTTGCTGAAGG - Intergenic
1174834642 20:53845107-53845129 ATCAGGGTGGTGGTCGCTGAAGG - Intergenic
1174922381 20:54717652-54717674 ATTAGGTTGTTGCTCTCAGAAGG + Intergenic
1174943525 20:54958630-54958652 ACTAGGTTGGTGGTTGCTGAAGG + Intergenic
1175088174 20:56478685-56478707 ATCAGGATGGTGGTTGCTGAAGG + Intronic
1175250532 20:57607702-57607724 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1176950924 21:15045570-15045592 ATCAGGCTTGTGGTTGCTGAAGG + Intronic
1177045999 21:16171148-16171170 ATCAGGGTGGTGGTTGCTGGAGG + Intergenic
1177162394 21:17562256-17562278 ATCAGGATGGTAGTTGCTGAAGG + Intronic
1177215753 21:18126179-18126201 ATCAGAGTGGTGGTTGCTGAAGG - Intronic
1177461205 21:21413783-21413805 ATCAGAATGTTGATTGCTGAAGG + Intronic
1179395286 21:41034083-41034105 ATCAGGTTGGTGGTCACTGAAGG + Intergenic
1179965010 21:44798301-44798323 ATCAGGGTGGTAGTTGCTGAAGG + Intronic
1180574342 22:16758853-16758875 ATCAGGGTAATGGTTGCTGAGGG - Intergenic
1180932326 22:19600883-19600905 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1181515950 22:23413234-23413256 ATGAGGATGGCGGTTGCTGAAGG - Intergenic
1181520168 22:23443265-23443287 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1181821566 22:25479858-25479880 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
1182731360 22:32497772-32497794 ATCAGGGTGCTGGTTGCTAAAGG - Intronic
1183008320 22:34922512-34922534 ATCAGGGTTGTGGTTGCTGAAGG + Intergenic
1183234160 22:36604578-36604600 ACCAGGGTGGTGGTTGCTGAAGG - Intronic
1183612373 22:38918038-38918060 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1184082870 22:42237002-42237024 ATTAGGGTGGTGGTTGCTGAAGG + Intronic
1185084547 22:48732827-48732849 ATCAGGGCGGTGGTTGCTGAAGG - Intronic
1185097100 22:48815770-48815792 ATTAGAGTGGTGGTTGCTGAAGG - Intronic
949354603 3:3165457-3165479 ATCAGGGTAGTGGTTGCTGAAGG - Intronic
949581082 3:5389135-5389157 ATTAGGTTGATGTTTTCTCATGG + Intergenic
949728818 3:7083208-7083230 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
949835448 3:8264666-8264688 ATGAGGTTGTTTGTTGCAGCAGG - Intergenic
950314881 3:11992531-11992553 ATCAGGGTGGTGGTTCCTGAAGG + Intergenic
950562241 3:13739152-13739174 ATCAGGGTGTTGGTTGCTAAAGG - Intergenic
950632953 3:14295636-14295658 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
950700061 3:14737627-14737649 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
950838724 3:15946131-15946153 ATCAGGGTGGCGGTTGCTGAAGG - Intergenic
950957832 3:17073476-17073498 ATGAGGGTGGTGGTTGCTGAAGG + Intronic
950988994 3:17411099-17411121 GTTAGGGTGGTGGTTGCTGAAGG - Intronic
951007268 3:17632627-17632649 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
951164300 3:19466528-19466550 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
951275976 3:20686722-20686744 ATCAGGGTGGTGGTTGTTGAAGG + Intergenic
951313137 3:21154845-21154867 ATCAGGGTGTTGGTTGTTGAAGG + Intergenic
951506794 3:23455812-23455834 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
951608717 3:24466854-24466876 ATCAGGGTGATGGTTGCTGAAGG + Intronic
952260579 3:31736084-31736106 AATAGAATGGTGGTTGCTGAGGG + Intronic
952309916 3:32179329-32179351 GGTAGGTTGGTGGTTGCTTAGGG - Intergenic
952515525 3:34100611-34100633 ATCAGGTTGCTGCTTGCTGAAGG + Intergenic
952597582 3:35037096-35037118 AATAGATTATTGGTTGCTTAGGG - Intergenic
952775033 3:37037513-37037535 ATCAGGGTGGTGATTGCTGAAGG - Intronic
952805839 3:37350939-37350961 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
953436213 3:42880135-42880157 ATCAGGGTGGTGGTTGCTGAGGG - Intronic
953484163 3:43279007-43279029 ATCAGGTTGGTGGTTGCTGAAGG - Intergenic
953486989 3:43309499-43309521 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
954019974 3:47730965-47730987 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
954944785 3:54411424-54411446 ATCAGGGTGATGGTTGCTAAAGG - Intronic
955212064 3:56951331-56951353 ATCAGGGTGGTGGTTACTGAAGG - Intronic
955381924 3:58445946-58445968 ATCAGGGTGATGGTTGCTGAAGG + Intergenic
955628576 3:60947731-60947753 ACTAGGTTGGTGGGTGCAGATGG - Intronic
955679350 3:61484179-61484201 ATAAGGCTGGTGGTTGCTGAAGG + Intergenic
956063407 3:65371515-65371537 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
956537990 3:70300242-70300264 ATTAGATTGTTGTTTACTCAAGG - Intergenic
956923908 3:73961501-73961523 AGTGGGTTATTGGTTGCTTAGGG - Intergenic
957115672 3:76021811-76021833 ATCAGGGTGGTGGTTTCTGAAGG + Intronic
957401166 3:79715376-79715398 ATCAGGGTGATGGTTGCCGAAGG - Intronic
957469004 3:80633928-80633950 ATCAAGTTGGTGGTTGCTGAAGG + Intergenic
957573037 3:81972802-81972824 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
957809495 3:85201472-85201494 ATTAGGATGGTAGTTGCTGAAGG + Intronic
957897072 3:86436272-86436294 ATTAGATTAGTGGTTGCTTATGG - Intergenic
957928893 3:86851602-86851624 ATCAAGGTGATGGTTGCTGAAGG - Intergenic
958121472 3:89295357-89295379 ATCAGGATGGTGGTTGCTGAAGG + Intronic
958492865 3:94799877-94799899 ATCAGGGTGGTGTTTGCTGAAGG + Intergenic
958494389 3:94825140-94825162 ATTAGGGTGGTGGTGGCTGAAGG + Intergenic
958655407 3:96995854-96995876 ATTAGGGTGGCAGTTGCTGAAGG + Intronic
958773183 3:98450147-98450169 ATCAGGATGGTGTTTGCTGAAGG + Intergenic
958800921 3:98754720-98754742 ATCAGGCTGGTGGTTGCTAAAGG - Intronic
958840469 3:99198168-99198190 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
958933399 3:100231593-100231615 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
959165078 3:102766559-102766581 ATTGGCGTGGTGGTTGCTGATGG + Intergenic
959195886 3:103181324-103181346 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
959210094 3:103367678-103367700 ATTAGAATGGTGGTTGCTGAAGG + Intergenic
959238418 3:103755608-103755630 ATCAGAGTGGTGGTTGCTGAAGG + Intergenic
959511319 3:107215980-107216002 ATCAGAGTGATGGTTGCTGAAGG - Intergenic
959821005 3:110735270-110735292 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
959873645 3:111357182-111357204 ATTAGGTTGGTGGTTGCTGAAGG - Intronic
959988538 3:112604365-112604387 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
960230134 3:115216392-115216414 ATCAGGGTGGTGGTTGTTGAGGG - Intergenic
960258739 3:115540278-115540300 ATCAGGGTGGTGGTGGCTGAAGG + Intergenic
960458075 3:117898506-117898528 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
960599645 3:119443440-119443462 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
960643941 3:119857172-119857194 ACCAGGATATTGGTTGCTGAAGG + Intronic
960657512 3:120022169-120022191 ATTAGGGTGGTGGTTGCTGAAGG - Intronic
960669313 3:120141067-120141089 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
960669467 3:120142634-120142656 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
961092313 3:124124675-124124697 ATCAGGATAGTGGTTGCTGAAGG - Intronic
961585276 3:127917056-127917078 ACTAAGTGATTGGTTGCTGATGG - Intronic
961613284 3:128158500-128158522 ATCAGGGTGGTGGTTGATGAAGG - Intronic
961732936 3:128980466-128980488 ATCAGGATGGTGGGTGCTGAGGG + Intronic
962116103 3:132509682-132509704 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
962461228 3:135614966-135614988 ACCAGGATGGTGGTTGCTGAAGG + Intergenic
962949306 3:140203414-140203436 AATAGGATGTTGGCTGATGAGGG + Intronic
963195359 3:142522075-142522097 ATTACCGTGGTGGTTGCTGAAGG - Intronic
963243186 3:143031430-143031452 GTTAGGGTGGTGGTAGCTGAAGG - Intronic
963243191 3:143031452-143031474 ATCAGGGTGGTGGTAGCTGAAGG - Intronic
963293052 3:143513037-143513059 ATAAGGCTGGTGGTTGCTGAAGG + Intronic
963608589 3:147436835-147436857 ATCAGGGTGATGGTTGCTGAAGG + Intronic
963664144 3:148160932-148160954 ATTAGGTTGTTGGTTGCTGAAGG - Intergenic
964061345 3:152528192-152528214 ATCAGGGTGGTGGTTACTGAAGG + Intergenic
964212366 3:154242786-154242808 ACTAGGGTGATGGTTGCTGAAGG - Intronic
964324265 3:155529710-155529732 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
964440075 3:156699389-156699411 ATCAGGGTGGTGATTGCTGAAGG - Intronic
964535138 3:157713018-157713040 ATTAGGGTGGTGATTGCTAAAGG - Intergenic
964596829 3:158442159-158442181 ATGAGGGTGGCGGTTGCTGAAGG + Intronic
964599012 3:158474464-158474486 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
964909623 3:161763842-161763864 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
965217956 3:165888627-165888649 ATGAGGGTGCTGCTTGCTGAAGG - Intergenic
965235778 3:166119716-166119738 ATTAGGGTAGTGGTTACTGAAGG - Intergenic
965269728 3:166599636-166599658 ATCAAGTTGGTGGTTGCCGAAGG + Intergenic
965363405 3:167768169-167768191 ATAAGGCTGGCGGTTGCTGAAGG - Intronic
965366784 3:167810652-167810674 ACCAGGGTGGTGGTTGCTGAAGG + Intronic
965595753 3:170409104-170409126 ATAAGGGTGGTGGTTGCTGAAGG - Intergenic
965794637 3:172427329-172427351 ATTCGCTTGCTGGTTGATGAAGG + Intergenic
965833607 3:172826720-172826742 ATCAGGCTGGTGGTTGCTGAAGG - Intergenic
965860539 3:173144424-173144446 ATCAGGATGGTGATTGCTGATGG + Intergenic
966096133 3:176205489-176205511 ATTAGGGTAGCGGTTGCTGAGGG - Intergenic
966098048 3:176229764-176229786 ATTAGGGTGATAGTTCCTGAAGG + Intergenic
966750687 3:183318938-183318960 ATCAGGGTGATGGTTGCCGAAGG + Intronic
967035043 3:185642605-185642627 ATGAGGGTGGTGGTTGCTGAAGG - Intergenic
967080294 3:186043509-186043531 ACTAGATTGTTGGGTGCTGAAGG + Intergenic
967399725 3:189047480-189047502 AATAGGGTGATGATTGCTGAAGG + Intronic
967542629 3:190685160-190685182 ATCAGGGTGATGGTTGTTGAAGG - Intergenic
967544910 3:190714127-190714149 ATCAGAGTGCTGGTTGCTGAAGG + Intergenic
968527445 4:1069367-1069389 ATTAGGTGGTTGATTGTTGGGGG + Intronic
968539555 4:1157381-1157403 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
969167211 4:5326753-5326775 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
969218023 4:5738528-5738550 ATGAGGGTAGTGGTTGCTGAAGG - Intronic
969280135 4:6165157-6165179 ATCAGAGTGGTGGTTGCTGAAGG - Intronic
970025296 4:11617437-11617459 GTTGGGCTGTTGGTTGCTTACGG + Intergenic
970578957 4:17456137-17456159 ATCAGGGTGGTGGTTGCCGAAGG - Intergenic
970814312 4:20136143-20136165 AGTAGATTGTTGGTTGCCTATGG + Intergenic
970847486 4:20558326-20558348 ATCAGGGTAATGGTTGCTGAAGG - Intronic
971086279 4:23279508-23279530 ATAAGAGTGGTGGTTGCTGAAGG - Intergenic
971679985 4:29685736-29685758 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
971918159 4:32902261-32902283 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
972099489 4:35395702-35395724 ATCAGGGTGATGGTCGCTGAAGG - Intergenic
972177456 4:36426118-36426140 ATCATGGTGGTGGTTGCTGAAGG + Intergenic
972383530 4:38541309-38541331 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
972677954 4:41278261-41278283 CTGAGGTTGTGTGTTGCTGAGGG - Intergenic
972746588 4:41938822-41938844 ATTAGGTTGTTAGTACCTGAAGG - Intronic
972768809 4:42176341-42176363 ATCAGGGTGGTGGTTGCTAAAGG + Intergenic
972776482 4:42246068-42246090 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
972837501 4:42890960-42890982 ATCAGGGTGGTAGTTGCTGAAGG - Intergenic
973128287 4:46616677-46616699 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
973537987 4:51904072-51904094 TTTAGGTATTTGGTTGCTGTGGG + Intronic
973901333 4:55475610-55475632 ATTAGGGTGGTGGTTGCTGAAGG - Intronic
974234179 4:59159945-59159967 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
974422413 4:61694624-61694646 ATCAGGGTGGTAGTTGCTGAAGG + Intronic
974423122 4:61704549-61704571 CTCAGGCTGGTGGTTGCTGAAGG + Intronic
974656083 4:64824452-64824474 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
974667473 4:64983350-64983372 ATCAGATTGGTGGTTGCTGAAGG - Intergenic
974833580 4:67218948-67218970 ATTAGGTTGTTGGGTCCTTTGGG + Intergenic
975077348 4:70227963-70227985 ATCAGGGTGATGGTTCCTGAAGG + Intronic
975133890 4:70855615-70855637 ATCAGTATGGTGGTTGCTGAAGG - Intergenic
975391766 4:73826732-73826754 ATCAGGAAGTTGGCTGCTGATGG + Intergenic
975686316 4:76919070-76919092 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
975875299 4:78828875-78828897 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
976154880 4:82132634-82132656 ATCAGGGTGGTGGTTGATGAAGG - Intergenic
976415540 4:84769890-84769912 ACCAGGGTGGTGGTTGCTGAAGG - Intronic
976468638 4:85401114-85401136 ATCAGGATGGTGGCTGCTGAAGG - Intergenic
976934739 4:90615958-90615980 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
977401367 4:96536567-96536589 ATCAGGGTACTGGTTGCTGAAGG - Intergenic
977539560 4:98300183-98300205 ATCAGGGTGCTGGTTGCTGAAGG - Intronic
977612661 4:99052278-99052300 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
977714878 4:100171091-100171113 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
977981133 4:103323500-103323522 ATCAGAATGGTGGTTGCTGAAGG + Intergenic
978082341 4:104609152-104609174 ATCAGGGTGGTGGTTGCTTAAGG + Intergenic
978125681 4:105132440-105132462 ATCAGGGTGGGGGTTGCTGAAGG + Intergenic
978260418 4:106750502-106750524 ATCAGGGTGGTGGTTCCTGAAGG + Intergenic
978523281 4:109638547-109638569 ATCAGGATGGTGGTTGCTGAAGG + Intronic
978530438 4:109706974-109706996 ATTAGGGTGGTAGTTGCTGAAGG - Intergenic
979313865 4:119236373-119236395 ATCAGGGTGATGGTTGCTGAAGG + Intronic
979345498 4:119581988-119582010 ATCAGGGTGGTGGTTGCTGACGG + Intronic
979448950 4:120846373-120846395 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
979658938 4:123230082-123230104 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
979744412 4:124193168-124193190 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
979973944 4:127172665-127172687 ATCAGGGTGATGGTTGCTAAAGG - Intergenic
980549593 4:134317098-134317120 ATCACCATGTTGGTTGCTGAAGG + Intergenic
980940496 4:139269917-139269939 ATAAGGTACTTGGTTTCTGATGG - Intronic
980952613 4:139396449-139396471 ATCAGGGTGGTGGTTGCTAAAGG + Intronic
981036930 4:140180522-140180544 ATCAGGGTGGTAGTTGCTGAAGG - Intergenic
981119467 4:141032984-141033006 ATCAGGGTGGTGGTTACTGAAGG + Intronic
981416714 4:144502128-144502150 ATTAGGGTGGTAGCTGCTGAAGG - Intergenic
981493192 4:145363244-145363266 ATTAGGGTGGTGGTTGATAAAGG - Intergenic
981764408 4:148231621-148231643 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
981924300 4:150121162-150121184 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
982036532 4:151351642-151351664 ATCAGGATGATGGTTGCAGAAGG - Intergenic
982130681 4:152226198-152226220 ATTAGGGTGTTGGTTACACAGGG - Intergenic
982169821 4:152650086-152650108 ATCAGGGTGGTGGTTGCTGATGG + Intronic
982247613 4:153369680-153369702 ATCAGGGTGATGGTTGCTGAAGG + Intronic
982488035 4:155992428-155992450 ATCATGATGATGGTTGCTGAAGG + Intergenic
983031448 4:162807240-162807262 ATTAGAGTGGTGGTTGCTGGGGG + Intergenic
983048556 4:163016159-163016181 ATCAGGGTGATGGTTGCTAAAGG - Intergenic
983086336 4:163449564-163449586 ATCAGGGTGGTGGTTGCTGTAGG + Intergenic
983157045 4:164361339-164361361 AGGAGGATGGTGGTTGCTGAAGG - Intronic
983276178 4:165620750-165620772 ATCAGGGTGGTGGTTGCTGAGGG - Intergenic
983290128 4:165791766-165791788 ATAAGGGTGGTGGTTGCTGAAGG + Intergenic
983301015 4:165925808-165925830 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
983333018 4:166355659-166355681 ATCAGGGTGGTGGTTACTGAAGG + Intergenic
983464620 4:168071524-168071546 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
984121265 4:175747726-175747748 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
984140112 4:175994664-175994686 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
984326138 4:178253564-178253586 ATCAGGGTGATGGTTGCTAAAGG + Intergenic
984344807 4:178509361-178509383 ATTAGATTAGTGGTTGCTTAGGG + Intergenic
984685748 4:182666457-182666479 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
984790183 4:183607918-183607940 ATTATGTTCCTGGTTGCTGGTGG + Intergenic
984898749 4:184565362-184565384 ATCAGGGTGATGGTTGCTGAAGG + Intergenic
985178064 4:187224433-187224455 ATGAGGATGCTGGATGCTGATGG + Intergenic
985310991 4:188598680-188598702 ATCAGCATGATGGTTGCTGAAGG + Intergenic
985328528 4:188799728-188799750 ATGAAGTTGATGGTTGCTGAAGG - Intergenic
986617376 5:9632382-9632404 ATCAGGCTGGTGGTTGATGAAGG + Intronic
986682014 5:10242087-10242109 ATGAGGGTGGTGGTTGCCGAAGG + Intronic
986738835 5:10688254-10688276 ATTGGGGTGGTGGTTGCTGAAGG - Intronic
986752953 5:10806444-10806466 ATCAGGATGGTGGTTTCTGAAGG - Intergenic
986862472 5:11943551-11943573 AGTAGATTGTTGGTTGCCTATGG + Intergenic
987095755 5:14547846-14547868 ATCAGGGTGGTGGTTGCTAAAGG + Intergenic
987124626 5:14800510-14800532 ATCAGGGTGGTGGTTCCTGAAGG - Intronic
987544591 5:19296884-19296906 ATCAGAATGATGGTTGCTGATGG - Intergenic
987602333 5:20087547-20087569 ATAAGGATGGTGTTTGCTGAAGG - Intronic
987732124 5:21787297-21787319 ATTGGGGTGGTGGTTGTTGAAGG - Intronic
987749841 5:22025547-22025569 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
987920115 5:24268859-24268881 ATTAGGATGGTGGTTGATGAAGG - Intergenic
988048337 5:25989678-25989700 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
988231088 5:28480331-28480353 ACAAGGGTGGTGGTTGCTGAAGG + Intergenic
988277695 5:29103779-29103801 ATCAGTGTGTTTGTTGCTGAAGG + Intergenic
988888971 5:35593521-35593543 ATCAGGGTGTTGCTTGCTGAAGG + Intergenic
989000957 5:36759781-36759803 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
989128712 5:38082755-38082777 ATCAGGGTGGTGGTTGCTGATGG - Intergenic
989374853 5:40750227-40750249 ATCAGGGTGGTGGTTACTGAAGG + Intronic
989454438 5:41626358-41626380 ATCAGGTTGGTGGTTGCTGAAGG + Intergenic
989634410 5:43519165-43519187 ATTCGGGTGGTGGTTGCCGAAGG - Intergenic
990522905 5:56596802-56596824 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
990697322 5:58434823-58434845 ATCAGATTGGTGGTTGCTGAAGG + Intergenic
990723733 5:58729423-58729445 AGCAGGTTGGTGTTTGCTGAGGG - Intronic
990789197 5:59457226-59457248 ATCAGGGTGGCGGTTGCTGAAGG - Intronic
991077632 5:62559130-62559152 ATCAGGATGGTGGTTGCTGTAGG + Intronic
991228751 5:64304918-64304940 ATTAGGGTGGTGGTTGCTGGAGG - Intronic
991270956 5:64780081-64780103 AATAGATTGGTGGTTGCTGGGGG - Intronic
991413011 5:66363590-66363612 ATTGGGGTGGTGGTTGCTGAAGG + Intergenic
991468417 5:66940244-66940266 ATCAGGGTGGTGGTTACTGAAGG + Intronic
991651028 5:68853843-68853865 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
992127805 5:73659951-73659973 ATCAGTTTGGTGGTTGCTGAAGG + Intronic
992271384 5:75067410-75067432 ATCATGGTGGTGGTTGCTGAAGG - Intergenic
992538289 5:77734855-77734877 ATTAGGATGGTGGTTGCTGAAGG - Intronic
992592894 5:78313849-78313871 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
992730450 5:79661732-79661754 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
992821011 5:80496243-80496265 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
992918092 5:81480540-81480562 ATCAGGGTGGTGTTTGCTGAAGG + Intronic
993596109 5:89858194-89858216 ATTAGGGTGGTGGTAGCCGAAGG + Intergenic
993892315 5:93489278-93489300 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
994020224 5:95014917-95014939 ATTAGGGTGGTGGTTGTTGAAGG - Intronic
994255681 5:97592845-97592867 ATCAGGTTGGTGGTTGCTGAAGG + Intergenic
994555631 5:101298070-101298092 ATCAGGGTACTGGTTGCTGAAGG + Intergenic
994626208 5:102222686-102222708 AGGTGGTGGTTGGTTGCTGAAGG - Intergenic
994967318 5:106690786-106690808 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
994996513 5:107070539-107070561 ATCAGGGTGATGGTTGCTGAAGG + Intergenic
995171641 5:109120668-109120690 ATTAGTTTGTTGATTGCTTTGGG + Intronic
995505612 5:112857579-112857601 ATCAGGATGATGGTTGCTGAAGG + Intronic
995658759 5:114457194-114457216 ATCAGGGTGGTGCTTGCTGAAGG - Intronic
995741558 5:115361067-115361089 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
995933353 5:117479002-117479024 ATCAGTATGGTGGTTGCTGAAGG - Intergenic
996512384 5:124331037-124331059 ATAAGGCTGGTGGTTGCTGAAGG + Intergenic
996517567 5:124389485-124389507 ATCAGGGTGGTGATTGCTGAAGG + Intergenic
996643216 5:125783377-125783399 ATCAGGGTGATGGTTGCTGAAGG - Intergenic
996673327 5:126145388-126145410 ATTAGGGTAGTGGTTGCTGAAGG - Intergenic
996693213 5:126363784-126363806 AGTAGGTTAGTGGTTGCTTAGGG + Intronic
996807331 5:127470944-127470966 ATCAGGGTGGTTGTTGCTGAAGG + Intergenic
997121104 5:131173894-131173916 ATCAGATTGGTGGTTGCTAAAGG + Intronic
997577102 5:134988279-134988301 ATCAGGATGATGGTTGCTGAAGG + Intronic
998847147 5:146322036-146322058 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
998883009 5:146663779-146663801 ATCAGGGTGGTAGTTGCTGAAGG + Intronic
999497116 5:152109887-152109909 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
999524528 5:152389647-152389669 ATGAGGGTGGTGGTTGCTGAAGG + Intergenic
999835015 5:155360327-155360349 ATCAGGGTGCTGGTTGCTGAAGG + Intergenic
1000129458 5:158281742-158281764 ATCAGGGTGATGGTTGTTGAAGG - Intergenic
1000492743 5:161935103-161935125 ATCAGGGTGGTGGTGGCTGAAGG - Intergenic
1000515236 5:162230850-162230872 ATTTTGTTATTGGTTGTTGATGG - Intergenic
1000590030 5:163146949-163146971 CTTAGCTTGTTGGTTTCTGTTGG - Intergenic
1000782529 5:165500387-165500409 ATCAGGGTGGTGGCTGCTGAGGG + Intergenic
1000821424 5:165989326-165989348 ATCAGGGTGTTGGTTGCTGAAGG - Intergenic
1000838886 5:166191031-166191053 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1001876001 5:175201533-175201555 ATTAGGGTGGTCGTTGCTGAAGG - Intergenic
1002822570 6:740037-740059 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1002964874 6:1954338-1954360 ATCAGGATGGTGGTTGCTAAAGG + Intronic
1002985234 6:2183770-2183792 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1003008256 6:2402067-2402089 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
1003085945 6:3061526-3061548 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
1003274912 6:4641642-4641664 ATCAGGGTTGTGGTTGCTGAAGG + Intergenic
1003660219 6:8053389-8053411 ATCAGGGTGGTGGTTGCAGAAGG - Intronic
1003662475 6:8075663-8075685 ATCAGGGTGGTGGTTGCTGGAGG + Intronic
1003830801 6:10009078-10009100 ATCAGGATGGTGGTTGCTGAAGG + Intronic
1003920936 6:10832482-10832504 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
1004188528 6:13443857-13443879 GTTAGGGTGCTGGTTGCTGAAGG - Intronic
1004371111 6:15053143-15053165 ATCAGGATGGTGGCTGCTGAAGG + Intergenic
1004439364 6:15633751-15633773 ATCAGGGTGGTGGTTACTGAAGG - Intronic
1004569136 6:16828123-16828145 ACCAGGGTGGTGGTTGCTGAAGG + Intergenic
1004858104 6:19771954-19771976 GTTAGGTTGGTGGTTGCTGAAGG - Intergenic
1006138087 6:31908696-31908718 ATTAGGGTGGTGGTTGCTGAAGG - Intronic
1006532685 6:34670337-34670359 ATTGGGGTGATGGTTGCAGATGG + Intronic
1006959404 6:37913106-37913128 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
1007017634 6:38484859-38484881 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1007121439 6:39385397-39385419 AGTAGGGTGCTGGGTGCTGATGG + Intronic
1007379914 6:41482392-41482414 ATCAGGGTGGCGGTTGCTGAAGG - Intergenic
1007588559 6:43007674-43007696 ATTATGTTGTTAGTTTCTTAAGG - Intronic
1007714009 6:43843400-43843422 TTTGGGTTGTTGCTTGCTTAGGG + Intergenic
1007863942 6:44946977-44946999 ATCAGGGTGGTGGTTGCCGAAGG - Intronic
1008161024 6:48075858-48075880 CTCAGGGTGATGGTTGCTGAAGG + Intergenic
1008761309 6:54854445-54854467 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1008831507 6:55769092-55769114 ATCAGGTTGGTGATTGCTGAAGG + Intronic
1009627624 6:66156439-66156461 ATCAGGGTGATGGCTGCTGAAGG - Intergenic
1010207638 6:73337284-73337306 TTTAAGTTGTTGATTTCTGATGG + Intergenic
1010711350 6:79178648-79178670 ATCAGGGTGGTGGTTTCTGAAGG - Intergenic
1010724415 6:79316912-79316934 ATCAGGATGGTGGTTGCTAAAGG + Intergenic
1010796103 6:80118476-80118498 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
1011096081 6:83664905-83664927 ATTAGGATGGTGGTTGCTGAAGG - Intronic
1011737197 6:90322933-90322955 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1012207720 6:96481367-96481389 ATCAGGGTGATAGTTGCTGAAGG + Intergenic
1012211399 6:96522256-96522278 ATTTGGTGGTTGGTGGGTGAGGG - Intronic
1012304641 6:97638210-97638232 ATTAGAGTGGTGGTTCCTGATGG - Intergenic
1012472204 6:99584663-99584685 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
1012836351 6:104274309-104274331 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1012930807 6:105314253-105314275 ATTGGGATGGTGGTTGCTGAAGG + Intronic
1013347237 6:109272992-109273014 ATTAGGGTGGTGGTTGCTGAAGG + Intergenic
1013493709 6:110676575-110676597 ATTAGAGTGGTGGTTACTGAAGG - Intronic
1013698764 6:112737402-112737424 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
1014035004 6:116756713-116756735 ATCAGGATGGTGGTTGCTGAAGG - Intronic
1014130482 6:117826118-117826140 ATCGGGGTGGTGGTTGCTGAAGG - Intergenic
1014319757 6:119912504-119912526 ATCGGGGTGGTGGTTGCTGAAGG - Intergenic
1014521690 6:122451169-122451191 AACAGGGTGTTGGTTGCTGCAGG - Intronic
1014528188 6:122525770-122525792 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1014617803 6:123625863-123625885 ATCAGGGTGATGGTTGCTAAAGG + Intronic
1015223681 6:130832363-130832385 TTTAGGATGTGCGTTGCTGAAGG - Intronic
1015939885 6:138438213-138438235 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1016039319 6:139415564-139415586 AGTAGGTTATTGTTTGCTTAGGG + Intergenic
1016087527 6:139932804-139932826 TTTAGGTGGATGGTTGATGAAGG - Intergenic
1016194443 6:141316387-141316409 ATCAGGGTGGTGGTTGCGGAAGG + Intergenic
1016257334 6:142123614-142123636 ATTGGGATGTTGGCTGCTGAAGG - Intergenic
1016343935 6:143090777-143090799 ATCTGGGTGGTGGTTGCTGAAGG + Intronic
1016931692 6:149417445-149417467 ATCAGGGTGGTGGCTGCTGAAGG - Intergenic
1017384856 6:153871807-153871829 ATCAGGGTGGTGGTTGCCGAAGG + Intergenic
1017799704 6:157883071-157883093 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1018470655 6:164094931-164094953 ATTTGGTTGTTGGCAGTTGATGG + Intergenic
1018691595 6:166349155-166349177 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
1018818451 6:167353952-167353974 ATCAGGGTGGAGGTTGCTGAAGG - Intronic
1018881273 6:167883787-167883809 ACCAGGGTGGTGGTTGCTGAAGG + Intronic
1019035493 6:169053144-169053166 ATTAGGGTGGTGGTTCCTGAAGG + Intergenic
1019060941 6:169257106-169257128 ATCAGGGTGGTGGTTGCTGATGG + Intergenic
1019591083 7:1832969-1832991 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1019691366 7:2415562-2415584 ATCAGGGCGGTGGTTGCTGAAGG + Intronic
1019822462 7:3255538-3255560 AGCAGGGTGGTGGTTGCTGAAGG - Intergenic
1019869511 7:3746347-3746369 ATCAGTCTGATGGTTGCTGAAGG + Intronic
1019932922 7:4235574-4235596 ATTAGGATGAGGGGTGCTGAGGG - Intronic
1020423994 7:8043001-8043023 ATCAGGATGGCGGTTGCTGAAGG - Intronic
1020596757 7:10215903-10215925 ATCAGGGTGGTGGTTGATGAAGG + Intergenic
1020727771 7:11837587-11837609 ATCAGGGTGGTAGTTGCTGAAGG - Intergenic
1020741041 7:12018750-12018772 ACGAGGGTGGTGGTTGCTGAAGG - Intergenic
1020802214 7:12745727-12745749 ATCAGGGTAGTGGTTGCTGAAGG - Intergenic
1020833446 7:13120088-13120110 ATGAGGGTGGTGGTTGCTGAAGG - Intergenic
1020859668 7:13475454-13475476 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
1020939281 7:14510116-14510138 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1020944671 7:14587674-14587696 ATCAGAGTGGTGGTTGCTGAAGG - Intronic
1021204353 7:17761663-17761685 ATTAGGCTGGTGTTTTCTGAAGG + Intergenic
1021267842 7:18547196-18547218 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1021376408 7:19913226-19913248 ATTATGGTTGTGGTTGCTGAAGG + Intergenic
1021614110 7:22485293-22485315 ATTAGGGTGGAGGTTGCTAAAGG - Intronic
1021829734 7:24592886-24592908 ATCAGGGTGGTGGTTGTTGAAGG + Intronic
1021933971 7:25611609-25611631 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1022006441 7:26270018-26270040 ATCAGGGTGATGGTTGCTAAAGG + Intergenic
1022066938 7:26868288-26868310 ATCAGGGTGGTGATTGCTGAAGG - Intronic
1022279741 7:28895322-28895344 ATCAGAGTGTTGGTTGCTGAAGG + Intergenic
1023026257 7:36052925-36052947 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1023099597 7:36702761-36702783 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1023724587 7:43129289-43129311 ATCAGGGTGGTGGTTACTGAAGG - Intronic
1024133461 7:46381546-46381568 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
1024336594 7:48213531-48213553 ATCAGGGTGGTGGTTGCTGGAGG + Intronic
1024716937 7:52089650-52089672 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
1025073535 7:55922577-55922599 ATCAGGGAGGTGGTTGCTGAAGG - Intronic
1025299617 7:57807772-57807794 ATCAGGGTGGTGGTTGCTGAGGG + Intergenic
1025938911 7:66059462-66059484 ATCAGGGTGGTGGTTCCTGAAGG - Intergenic
1026092406 7:67311815-67311837 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
1026255936 7:68711315-68711337 ATCAGGGTGGTGGTTGCTGACGG + Intergenic
1026415477 7:70175604-70175626 ATCAGACTGGTGGTTGCTGAAGG - Intronic
1026489764 7:70852545-70852567 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1026873374 7:73866602-73866624 CATAGGTTGTTGGGTGATGATGG - Intergenic
1027276127 7:76558318-76558340 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
1027511904 7:79093627-79093649 ATAAGGGTGGTGGTTGCTCAAGG + Intronic
1027526519 7:79276373-79276395 ATCAGGGTGGTGGTTGCTAAAGG - Intronic
1027526592 7:79277188-79277210 ATCAGGGTGGTAGTTGCTGAAGG - Intronic
1027557485 7:79684266-79684288 GTTAGGTTGTTGTTTTCTTATGG + Intergenic
1027742546 7:82029126-82029148 ATTAAAGTGGTGGTTGCTGAGGG - Intronic
1027917560 7:84345337-84345359 ATTAAGGTGGTGGTTGCTAAAGG + Intronic
1028029059 7:85886209-85886231 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1028349594 7:89829275-89829297 ATCAGGATGGTGGTTGCTAAAGG - Intergenic
1028578054 7:92375220-92375242 AACAGGGTGGTGGTTGCTGAAGG + Intronic
1028661039 7:93275415-93275437 ATCAGGGTGCTGGTTGCTAAAGG - Intronic
1028696081 7:93714715-93714737 ATCAGGCTGGTGATTGCTGAAGG - Intronic
1028870715 7:95768910-95768932 ATCAGGGTGGTTGTTGCTGAAGG - Intergenic
1028935515 7:96459546-96459568 ACTAGGTGGTTGGTGGTTGACGG + Intergenic
1028962354 7:96762890-96762912 ATTAGGATGGTGGTTGCTGGGGG - Intergenic
1029050064 7:97676725-97676747 ATTAGGGTGGTGGTTGCTGAAGG - Intergenic
1029377843 7:100191685-100191707 ATCAGGGTAGTGGTTGCTGAAGG + Intronic
1029981296 7:104881838-104881860 ATGAGGGTGGTGGCTGCTGAAGG - Intronic
1029994505 7:104993877-104993899 ATTAAGTTGATGTTTGCTGCAGG - Intergenic
1030443679 7:109622324-109622346 ATTAGATTATTGGTTGCTAGGGG - Intergenic
1030491471 7:110240481-110240503 ATCAGTGTGGTGGTTGCTGAAGG - Intergenic
1030504991 7:110410114-110410136 ATCGGGATGGTGGTTGCTGAAGG + Intergenic
1030522194 7:110611702-110611724 AACAGGCTGGTGGTTGCTGAGGG + Intergenic
1031498863 7:122486826-122486848 ATCAGGTTGCTGGTTGTTGAAGG - Intronic
1031654733 7:124340468-124340490 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1031815155 7:126424406-126424428 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
1031827466 7:126584029-126584051 ATTAGGGTGACAGTTGCTGAAGG - Intronic
1031954888 7:127932694-127932716 ATCAGGGTGGTGGTTGCTGATGG - Intronic
1032180746 7:129674844-129674866 ATCAGGGTGGTTGTTGCTGAAGG + Intronic
1032235348 7:130117273-130117295 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1032768913 7:135028169-135028191 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1033080395 7:138291113-138291135 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1033141168 7:138827965-138827987 ATCAGGGTGGTGGTTGGTGAAGG - Intronic
1033468870 7:141624976-141624998 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1034303358 7:150034246-150034268 ACTAGGTTTTTAGTTGCTAAAGG - Intergenic
1034404682 7:150895350-150895372 ATCAGGGTGGTGGTTCCTGAAGG - Intergenic
1034568977 7:151939974-151939996 ATCAGGGTGGTGGTTCCTGAAGG - Intergenic
1035066809 7:156111129-156111151 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1036478021 8:9111423-9111445 AGCAGGATGGTGGTTGCTGAAGG + Intronic
1037218377 8:16485841-16485863 ATCAGGATGATGTTTGCTGAAGG + Intronic
1037223639 8:16555759-16555781 TTTAGTTTGTTGGTTTCTCAGGG + Intronic
1037327694 8:17710141-17710163 ATTAGGGTAGTGGTTGCTGAAGG + Intronic
1037417294 8:18665927-18665949 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
1037435487 8:18858403-18858425 ATCAGGGTGGTGGTTGCAGAAGG + Intronic
1037551769 8:19981168-19981190 AATAGATTAGTGGTTGCTGAAGG + Intergenic
1038130482 8:24725280-24725302 ATTAGGGTTGTGATTGCTGAAGG - Intergenic
1038527089 8:28284594-28284616 ATCAGGGTGGTGGTTGCTGAGGG - Intergenic
1039144773 8:34435412-34435434 ATTAGTTGCTTGGTTGCTGTTGG + Intergenic
1039253985 8:35698434-35698456 AGTAGAATGGTGGTTGCTGAGGG - Intronic
1039337209 8:36604506-36604528 ATCAGGGTGATGGTTGCTGAAGG + Intergenic
1039382242 8:37096980-37097002 TTTAGGGTGGTGGTTGCTGAAGG - Intergenic
1039702133 8:39972753-39972775 TTCAGGATGTTGGTTGCTGAAGG - Intronic
1040075894 8:43229995-43230017 ATCAGGGTGGTGGTTGCTAAAGG + Intergenic
1040541799 8:48364219-48364241 AATAGGTTAGTGGTTGCTAAGGG - Intergenic
1040841281 8:51787910-51787932 ATCAGGATGGTGGTTGCTGAAGG - Intronic
1041099960 8:54386142-54386164 ATCAGAATGGTGGTTGCTGAAGG + Intergenic
1041230960 8:55751512-55751534 ATTAGATTTCTGATTGCTGATGG - Intronic
1041779905 8:61566680-61566702 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1041822424 8:62052629-62052651 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1042045200 8:64643520-64643542 ATTAGGGTGGTGATTACTGAAGG + Intronic
1042154224 8:65824604-65824626 ATCAGGGTGGGGGTTGCTGAAGG - Intronic
1042409710 8:68449792-68449814 ATCAGGGTGTTGGCTACTGAAGG + Intronic
1042548210 8:69970155-69970177 ATCAGGGTGGTGGTTGCTAAAGG - Intergenic
1042686540 8:71447871-71447893 ATCAGGATGGAGGTTGCTGAAGG + Intronic
1042841494 8:73128674-73128696 ATCAGGGTGGTGGTTGCTTAAGG - Intergenic
1043103257 8:76074263-76074285 ATTATTTTATTGATTGCTGAAGG - Intergenic
1043305829 8:78793631-78793653 ATCAGAGTGGTGGTTGCTGAAGG + Intronic
1043603745 8:81973842-81973864 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1043722409 8:83561942-83561964 ATCAGGGTGGTGGTTGCTGGAGG + Intergenic
1043810845 8:84738051-84738073 ATTTGGTTGTAAGTTCCTGAAGG - Intronic
1043862816 8:85340782-85340804 ATCAGGATAGTGGTTGCTGAAGG - Intronic
1044461372 8:92448495-92448517 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
1044889324 8:96815994-96816016 ATGAGGGTGGTGGTTGCTGAAGG + Intronic
1045038522 8:98197424-98197446 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1045129360 8:99131751-99131773 ATCAGGGTGGTGGTTGCTAAAGG + Intronic
1045158159 8:99503349-99503371 ATCGGGGTGGTGGTTGCTGAAGG + Intronic
1045355270 8:101382324-101382346 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1045381257 8:101629205-101629227 ATCAGGGTGAGGGTTGCTGAAGG - Intronic
1045465385 8:102464731-102464753 ATTAGGGTGGTGGTTACTGAAGG + Intergenic
1045541653 8:103092107-103092129 ATCAGGATGGTAGTTGCTGAAGG + Intergenic
1045573144 8:103390742-103390764 ATCAGGTTGGTGGTTGCTGAAGG - Intergenic
1045711185 8:104986315-104986337 ATTAGATTGTGAGTTTCTGAAGG + Intronic
1045889459 8:107137272-107137294 ATCAGGGTGGTAGTTGCTGAAGG + Intergenic
1045967181 8:108038649-108038671 ATCAGTGTGGTGGTTGCTGAAGG - Intronic
1046111687 8:109733359-109733381 TTTAGCCTGTTGGTGGCTGAAGG + Intergenic
1046168506 8:110472357-110472379 GTGAGGGTGGTGGTTGCTGAAGG + Intergenic
1046201347 8:110932128-110932150 ATCAGGTTGGTGATTGCTGAAGG + Intergenic
1047178029 8:122559892-122559914 ATCAGGGTGCTGGTTGCTGAAGG + Intergenic
1047192217 8:122688435-122688457 ATCAGGTTGTTGGTTGGTCAGGG + Intergenic
1047207627 8:122816123-122816145 ATCAGAGTGGTGGTTGCTGAAGG - Intronic
1047560530 8:125983251-125983273 ATCAGGGTGGTGGTTACTGAGGG - Intergenic
1047602778 8:126443124-126443146 ACTAGGTTAGTGGTTGCTTAGGG + Intergenic
1047703804 8:127477353-127477375 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1048079269 8:131107529-131107551 ATCAGGGTGGTAGTTGCTGAAGG + Intergenic
1048362901 8:133713485-133713507 AGTGGGCTGCTGGTTGCTGATGG + Intergenic
1048433526 8:134393354-134393376 ATCAGGTTGGTGTTTACTGACGG - Intergenic
1048902603 8:139053669-139053691 ATGGGGTTGGTGGTTGCCGAAGG - Intergenic
1048975364 8:139669213-139669235 ATTAGGGTGGTGGTTGCTAAAGG + Intronic
1049145393 8:140997529-140997551 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1049628852 8:143640335-143640357 ATCAGGGTGATGGTTGCTGAAGG + Intronic
1049739269 8:144228428-144228450 ATCAGGGCGGTGGTTGCTGAAGG + Intronic
1050437103 9:5622682-5622704 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1050967532 9:11825594-11825616 ATGAGGGTGGTGATTGCTGAAGG - Intergenic
1051009989 9:12400042-12400064 ATCAGGGTGGTGATTGCTGAAGG - Intergenic
1051019480 9:12524851-12524873 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1051084797 9:13336018-13336040 ATCAGGGTGGTAGTTGCTGAAGG + Intergenic
1051147065 9:14038272-14038294 ATCAGTGTGGTGGTTGCTGAAGG + Intergenic
1051254319 9:15196916-15196938 TTCAGGGTGGTGGTTGCTGAAGG - Intronic
1051304765 9:15697798-15697820 ATCAGGGTGGTGGTGGCTGAAGG + Intronic
1051388344 9:16535969-16535991 ATTAGGTTGTTACTGGCTGTTGG - Intronic
1051767264 9:20539072-20539094 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1051777627 9:20653535-20653557 ATCCGGGTGGTGGTTGCTGAAGG + Intergenic
1051944937 9:22556708-22556730 ATCAGGGTGATGCTTGCTGAAGG + Intergenic
1051974748 9:22935735-22935757 ATCAGGTCATTGGCTGCTGAGGG - Intergenic
1052186771 9:25606563-25606585 ATTAGAGTGATGGTTGCTGAAGG - Intergenic
1052442526 9:28515952-28515974 ATCAGAGTGGTGGTTGCTGAAGG - Intronic
1052502365 9:29307837-29307859 ACTATGTGGATGGTTGCTGAAGG + Intergenic
1052543164 9:29837133-29837155 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1052734477 9:32326249-32326271 ATCAGGCTGGTGGTTGCTGAAGG + Intergenic
1053132670 9:35626650-35626672 ATCAGGATGGTAGTTGCTGAAGG - Intronic
1053171273 9:35886840-35886862 AGTAGGTTAGTGGTTGCTTAGGG - Intergenic
1054656128 9:67668176-67668198 ATCAAGGTGGTGGTTGCTGAGGG + Intergenic
1054779199 9:69151078-69151100 ATTAGATTGGTGGTTGCCTAGGG + Intronic
1054839543 9:69721672-69721694 ATCAGAGTGGTGGTTGCTGAAGG - Intronic
1054994982 9:71375724-71375746 ATCAGGATGGTGGTTGCTGAAGG - Intronic
1055039218 9:71850784-71850806 ACCAGGATGGTGGTTGCTGAAGG + Intergenic
1055190111 9:73508600-73508622 ATCAGGGTGGTGATTGCTGAAGG - Intergenic
1055296921 9:74842865-74842887 ATCAGAATGGTGGTTGCTGAAGG + Intronic
1055309179 9:74960747-74960769 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1055402233 9:75936228-75936250 CTCAGGGTGGTGGTTGCTGAAGG + Intronic
1055434948 9:76283351-76283373 ATCAGGGTGGTGGTTTCTGAAGG - Intronic
1055534523 9:77224910-77224932 ATCAGGGTGGTGATTGCTGAAGG - Intronic
1055812676 9:80167893-80167915 ATTGGGGTTGTGGTTGCTGAAGG + Intergenic
1056181534 9:84088110-84088132 ATCAGGGTAGTGGTTGCTGAAGG + Intergenic
1056191608 9:84189799-84189821 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1056227391 9:84509457-84509479 ATCATGGTGCTGGTTGCTGAAGG - Intergenic
1056317731 9:85407610-85407632 AATAGATTAATGGTTGCTGAGGG + Intergenic
1056879163 9:90373247-90373269 ATCAGGGTGGTGATTGCTGAAGG - Intergenic
1057250324 9:93495724-93495746 ATAAGGGTGGTGGTTGCTGGAGG + Intronic
1057287197 9:93766873-93766895 ATCAGGGTGGTGGTTGCTAAAGG + Intergenic
1058196443 9:101982878-101982900 ATCAGGCTGGTGGTTGTTGAAGG - Intergenic
1058314654 9:103550130-103550152 ATTATGTTGTTGCTTTCTGCTGG - Intergenic
1059228140 9:112692254-112692276 GTTAGGGTGGTGGTGGCTGAAGG + Intronic
1059559005 9:115313512-115313534 GTGAGGGTGGTGGTTGCTGAAGG - Intronic
1059834145 9:118130961-118130983 ATTAGGGTGGTGGCTGCTGAAGG - Intergenic
1060565442 9:124587066-124587088 ATCAGGGTGGTGGTTGCTGAAGG - Intronic
1061494944 9:130967851-130967873 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
1185714720 X:2331901-2331923 ATCAGGGTGGTGGTTGCTGAGGG - Intronic
1186255876 X:7718931-7718953 ACTAGGATGGTGGTTGCTGGAGG + Intergenic
1186492958 X:9989288-9989310 ATCAGGGTGGTGATTGCTGAAGG - Intergenic
1186535877 X:10347837-10347859 CTCAGGATGGTGGTTGCTGAAGG - Intergenic
1186706897 X:12149866-12149888 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
1186942199 X:14521950-14521972 AACAGGGTGGTGGTTGCTGAAGG + Intergenic
1186953454 X:14654176-14654198 CTTAGGGTGGTGGTTGCTGAAGG - Intronic
1186994913 X:15110202-15110224 ATCAGGGTGGTCGTTGCTGAAGG - Intergenic
1187026793 X:15444212-15444234 ATTAGAGTGGTGGTTGCTGAAGG - Intronic
1187074955 X:15925604-15925626 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1187343223 X:18440039-18440061 ATCAGGATGGTGGTTGCTGAAGG + Intronic
1187474264 X:19596466-19596488 ATCAGGGTGGTGGTGGCTGAAGG + Intronic
1187896414 X:23984065-23984087 ATTAGGTGTTTGCTTTCTGAAGG - Exonic
1188139405 X:26530090-26530112 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1188221941 X:27551276-27551298 ATCAGCGTGGTGGTTGCTGAAGG - Intergenic
1188583202 X:31740747-31740769 ATCAGGGTGGCGGTTGCTGAAGG + Intronic
1189014667 X:37084870-37084892 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1189072558 X:37879755-37879777 ATCAGGGTGGTGGCTGCTGAAGG - Intronic
1189263504 X:39695168-39695190 ATCAGGATGGTGGTTGCTGAAGG + Intergenic
1189424598 X:40886772-40886794 AGCAGGGTGGTGGTTGCTGAAGG + Intergenic
1189547331 X:42055240-42055262 TTGAGAGTGTTGGTTGCTGAAGG - Intergenic
1189708462 X:43783698-43783720 ATCAGGGTGGTGGCTGCTGAAGG + Intronic
1189788388 X:44580575-44580597 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1189829982 X:44962880-44962902 ATCAGGGTGGTGGTTGCTGCAGG + Intronic
1189923219 X:45924457-45924479 ATCAGGGTGGTGATTGCTGAAGG - Intergenic
1189951838 X:46240294-46240316 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1189964336 X:46356322-46356344 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
1190005653 X:46734895-46734917 AGTAGGTTAATGGTTGCCGAGGG - Intronic
1190171905 X:48117829-48117851 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
1190177498 X:48163183-48163205 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
1190180676 X:48189438-48189460 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
1190189448 X:48264592-48264614 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
1190193725 X:48298940-48298962 ATCAAGGTGGTGGTTGCTGAAGG - Intergenic
1190210143 X:48439805-48439827 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
1190482040 X:50887141-50887163 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1190486735 X:50934212-50934234 ATCAGAGTGGTGGTTGCTGAAGG - Intergenic
1190655186 X:52605847-52605869 ATCAAGGTGATGGTTGCTGAAGG - Intergenic
1190658208 X:52631082-52631104 ATCAAGGTGGTGGTTGCTGAAGG + Intergenic
1190660240 X:52647570-52647592 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
1190666364 X:52699740-52699762 ATCAAGGTGGTGGTTGCTGAAGG - Intronic
1190673054 X:52758670-52758692 ATCAAGGTGGTGGTTGCTGAAGG + Intronic
1190814363 X:53916285-53916307 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1190814674 X:53919420-53919442 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1191926241 X:66313469-66313491 ATCAGGGTCGTGGTTGCTGAAGG + Intergenic
1192028420 X:67482061-67482083 ATGAGGGTGGTGGTTGCTGAAGG + Intergenic
1192480685 X:71482687-71482709 ATCAGGGTGGTGGTTGCTGAAGG + Intronic
1192668482 X:73113357-73113379 ATAAGGCTGATTGTTGCTGAAGG + Intergenic
1192700976 X:73472461-73472483 ATCAGGGAGGTGGTTGCTGAAGG + Intergenic
1193316336 X:80069779-80069801 ATAAGGTTTTTGGGTGCTGCTGG + Intergenic
1193395965 X:80983555-80983577 ATCAGGGTGGTGGCTGCTGAAGG + Intergenic
1193652065 X:84148818-84148840 ATCAGGGTGGTGGCTGCTGAAGG + Intronic
1193686024 X:84578209-84578231 ATCATGGTGGTGGTTGCTGAAGG - Intergenic
1194588985 X:95772997-95773019 ATTAGGGTGGTGATTACTGAAGG - Intergenic
1194591812 X:95808468-95808490 ATCAGGATCGTGGTTGCTGAAGG - Intergenic
1194607020 X:95993111-95993133 ATTAGGTTGTGGGTATATGAGGG - Intergenic
1194759981 X:97784562-97784584 ATCATGATGGTGGTTGCTGAAGG - Intergenic
1194862375 X:99016566-99016588 ATCAGGGTGGTGGTTGTTGAAGG - Intergenic
1194874730 X:99173072-99173094 ATCAGTGTGGTGGTTGCTGAAGG + Intergenic
1194940384 X:100002179-100002201 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1195011326 X:100734759-100734781 ATCAGGGTGATGGTTCCTGAAGG - Intergenic
1195792507 X:108603623-108603645 ATCAGGGTGATGGTTGCTGAAGG + Intronic
1196113182 X:111969086-111969108 ATAAGGGTGGGGGTTGCTGAAGG - Intronic
1196378402 X:115061698-115061720 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
1196564170 X:117185540-117185562 ATCCGGTTGGTGGTTGCTGAAGG - Intergenic
1196721794 X:118861297-118861319 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1197344302 X:125313877-125313899 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1197358339 X:125465849-125465871 ACTAGGGCATTGGTTGCTGAAGG + Intergenic
1197444037 X:126526350-126526372 ATCAGAGTGGTGGTTGCTGAAGG + Intergenic
1197474094 X:126898473-126898495 ATCAGGATGGTGGTTGCTGAAGG - Intergenic
1197505326 X:127295351-127295373 ATCAAGATGATGGTTGCTGAAGG + Intergenic
1197557138 X:127969732-127969754 ATCAGGGTGGTGGTTGCTGAAGG + Intergenic
1197628319 X:128828822-128828844 ATCAGGGTGGTGGTTGGTGAAGG - Intergenic
1197687510 X:129457092-129457114 ATCAGGGTGGTTGTTGCTGAAGG - Intronic
1197831018 X:130642667-130642689 ATCAGGTTGGAGGTTGCTGAAGG - Intronic
1197987547 X:132282896-132282918 ATTAGGGAGGTGGTTGTTGAAGG - Intergenic
1198543201 X:137662275-137662297 ATCAGGATGCTAGTTGCTGATGG - Intergenic
1198551682 X:137751991-137752013 ATTAGGGGATTGGTTGATGAAGG - Intergenic
1198607116 X:138353498-138353520 ATCATGGTGGTGGTTGCTGAAGG - Intergenic
1198621233 X:138512473-138512495 ATCAAGTTGGTGGTTGCTGAAGG + Intergenic
1198819065 X:140626211-140626233 ATAAAGATGTTAGTTGCTGAAGG - Intergenic
1198826341 X:140702177-140702199 ATCAGGGTGGTGGTTACTGAAGG + Intergenic
1198985720 X:142450624-142450646 AATAGATTGATGGTTGCTGAGGG - Intergenic
1199054504 X:143277377-143277399 ATCAGGGTGGTGGTTACTGAAGG - Intergenic
1199089802 X:143678342-143678364 ATGATGATGTTGGGTGCTGACGG - Intergenic
1199103141 X:143829688-143829710 ATGAGGGTGATGGTTGCTGAAGG - Intergenic
1199144998 X:144354510-144354532 ATCAGGGTGGTGGTTGATGAAGG + Intergenic
1199289285 X:146088544-146088566 ATCATGGTGGTGGTTGCTGAAGG + Intergenic
1199405106 X:147448098-147448120 ATCAGGGTGATGGTTGCTGAAGG - Intergenic
1200367540 X:155683354-155683376 ATCAGGGTGGTGGTTGCTGAAGG - Intergenic
1200389030 X:155924695-155924717 ATCAGGCTGGTGGTTGCTGAAGG + Intronic
1201562493 Y:15332931-15332953 ATGAGGTTGCTGGCTGCAGATGG + Intergenic
1201755143 Y:17478995-17479017 AATAAGTTTTTGGTTGATGAAGG + Intergenic
1201846409 Y:18426990-18427012 AATAAGTTTTTGGTTGATGAAGG - Intergenic
1202580889 Y:26379274-26379296 AGTAGGTTGGTGGTTGCTTAGGG - Intergenic