ID: 963672440

View in Genome Browser
Species Human (GRCh38)
Location 3:148268996-148269018
Sequence CAAGAGAAACAATTTTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963672440_963672441 -1 Left 963672440 3:148268996-148269018 CCACTTTAAAATTGTTTCTCTTG No data
Right 963672441 3:148269018-148269040 GTCCCACATTTTACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963672440 Original CRISPR CAAGAGAAACAATTTTAAAG TGG (reversed) Intergenic
No off target data available for this crispr