ID: 963672441

View in Genome Browser
Species Human (GRCh38)
Location 3:148269018-148269040
Sequence GTCCCACATTTTACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963672439_963672441 27 Left 963672439 3:148268968-148268990 CCACTTTTTTGTTTTCAAGTTAG No data
Right 963672441 3:148269018-148269040 GTCCCACATTTTACTAGAGCAGG No data
963672440_963672441 -1 Left 963672440 3:148268996-148269018 CCACTTTAAAATTGTTTCTCTTG No data
Right 963672441 3:148269018-148269040 GTCCCACATTTTACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963672441 Original CRISPR GTCCCACATTTTACTAGAGC AGG Intergenic
No off target data available for this crispr