ID: 963673742

View in Genome Browser
Species Human (GRCh38)
Location 3:148282499-148282521
Sequence CTGTTTCTGGGGAAGCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963673738_963673742 -9 Left 963673738 3:148282485-148282507 CCTTGTTTCGGGATCTGTTTCTG No data
Right 963673742 3:148282499-148282521 CTGTTTCTGGGGAAGCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963673742 Original CRISPR CTGTTTCTGGGGAAGCCAAC TGG Intergenic
No off target data available for this crispr