ID: 963674242

View in Genome Browser
Species Human (GRCh38)
Location 3:148288312-148288334
Sequence GAGTGTGGCACAGGCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963674242_963674248 12 Left 963674242 3:148288312-148288334 CCCTCCCTGCCTGTGCCACACTC No data
Right 963674248 3:148288347-148288369 TTCACCACAGAGCTAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963674242 Original CRISPR GAGTGTGGCACAGGCAGGGA GGG (reversed) Intergenic
No off target data available for this crispr