ID: 963684949

View in Genome Browser
Species Human (GRCh38)
Location 3:148421605-148421627
Sequence CAAGAAACTCCCCCTTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963684949_963684951 3 Left 963684949 3:148421605-148421627 CCAATTTAAGGGGGAGTTTCTTG No data
Right 963684951 3:148421631-148421653 TTTGCCTCTGGTATCTCCCACGG No data
963684949_963684952 6 Left 963684949 3:148421605-148421627 CCAATTTAAGGGGGAGTTTCTTG No data
Right 963684952 3:148421634-148421656 GCCTCTGGTATCTCCCACGGTGG No data
963684949_963684950 -9 Left 963684949 3:148421605-148421627 CCAATTTAAGGGGGAGTTTCTTG No data
Right 963684950 3:148421619-148421641 AGTTTCTTGTTTTTTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963684949 Original CRISPR CAAGAAACTCCCCCTTAAAT TGG (reversed) Intergenic
No off target data available for this crispr