ID: 963686007

View in Genome Browser
Species Human (GRCh38)
Location 3:148434789-148434811
Sequence TTGCATCAAAGTAGATAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963686006_963686007 -4 Left 963686006 3:148434770-148434792 CCTTCTTGAAGCTGTCTATTTGC No data
Right 963686007 3:148434789-148434811 TTGCATCAAAGTAGATAAATTGG No data
963686005_963686007 -1 Left 963686005 3:148434767-148434789 CCTCCTTCTTGAAGCTGTCTATT No data
Right 963686007 3:148434789-148434811 TTGCATCAAAGTAGATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963686007 Original CRISPR TTGCATCAAAGTAGATAAAT TGG Intergenic
No off target data available for this crispr