ID: 963688750

View in Genome Browser
Species Human (GRCh38)
Location 3:148471951-148471973
Sequence GAAAAGGCACTGATGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963688747_963688750 -5 Left 963688747 3:148471933-148471955 CCATAGCTGTAAGTGAAAGAAAA No data
Right 963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG No data
963688744_963688750 7 Left 963688744 3:148471921-148471943 CCCCTAACAAGGCCATAGCTGTA No data
Right 963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG No data
963688746_963688750 5 Left 963688746 3:148471923-148471945 CCTAACAAGGCCATAGCTGTAAG No data
Right 963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG No data
963688745_963688750 6 Left 963688745 3:148471922-148471944 CCCTAACAAGGCCATAGCTGTAA No data
Right 963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963688750 Original CRISPR GAAAAGGCACTGATGCAACA GGG Intergenic
No off target data available for this crispr