ID: 963702718

View in Genome Browser
Species Human (GRCh38)
Location 3:148645969-148645991
Sequence TAGAACATGGAGAAGAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963702716_963702718 -9 Left 963702716 3:148645955-148645977 CCTTGAGTCAAAGGTAGAACATG No data
Right 963702718 3:148645969-148645991 TAGAACATGGAGAAGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963702718 Original CRISPR TAGAACATGGAGAAGAAATT AGG Intergenic
No off target data available for this crispr