ID: 963704217

View in Genome Browser
Species Human (GRCh38)
Location 3:148665620-148665642
Sequence AATGAGAAGACCAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963704217_963704223 18 Left 963704217 3:148665620-148665642 CCTCCCTCCTTGGTCTTCTCATT No data
Right 963704223 3:148665661-148665683 AGTTCACTTTCAGCCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963704217 Original CRISPR AATGAGAAGACCAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr