ID: 963704512

View in Genome Browser
Species Human (GRCh38)
Location 3:148669368-148669390
Sequence ATTTGAACACAGATGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963704512_963704515 5 Left 963704512 3:148669368-148669390 CCTACCTACATCTGTGTTCAAAT No data
Right 963704515 3:148669396-148669418 TCTTATAAGCCATTGGATTAAGG No data
963704512_963704514 -2 Left 963704512 3:148669368-148669390 CCTACCTACATCTGTGTTCAAAT No data
Right 963704514 3:148669389-148669411 ATTTCTCTCTTATAAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963704512 Original CRISPR ATTTGAACACAGATGTAGGT AGG (reversed) Intergenic
No off target data available for this crispr