ID: 963715702

View in Genome Browser
Species Human (GRCh38)
Location 3:148801236-148801258
Sequence AGTTGAATATTGACCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963715702_963715704 9 Left 963715702 3:148801236-148801258 CCCTCAGGGGTCAATATTCAACT 0: 1
1: 0
2: 1
3: 7
4: 102
Right 963715704 3:148801268-148801290 ATATTTAACCTCTTCTTAATTGG 0: 1
1: 0
2: 1
3: 20
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963715702 Original CRISPR AGTTGAATATTGACCCCTGA GGG (reversed) Intronic
902099073 1:13970477-13970499 AGTTGGAGTTTGAACCCTGAGGG + Intergenic
903899210 1:26630924-26630946 AGTTAAATATTGGCCACTAAGGG + Intergenic
908452280 1:64267895-64267917 AGCTAAATATTGAACCCGGAAGG - Intergenic
915755918 1:158259710-158259732 GATTGACTATTGACCCCAGATGG + Intergenic
918597784 1:186312325-186312347 AGGTGAATATTGAATTCTGATGG - Exonic
921296773 1:213711938-213711960 AGGTGTCTGTTGACCCCTGATGG + Intergenic
1066593788 10:37025813-37025835 AGTTGGATTTTGAACCCAGATGG + Intergenic
1067873658 10:49985185-49985207 AGTTGAATATAAACCTCTGTAGG - Intronic
1068202687 10:53803364-53803386 AATTGAATATTGACTCTCGAGGG - Intronic
1073033633 10:100547887-100547909 AGTACAAGATGGACCCCTGAGGG + Intronic
1073077928 10:100836288-100836310 GGGTGAATATTGACCCTAGATGG - Intergenic
1074280976 10:112051209-112051231 CATTGAATATTGATCCTTGAGGG - Intergenic
1075030398 10:119020841-119020863 AGCTGAATAATGACCCCAAAAGG + Intergenic
1076289260 10:129331831-129331853 AGCTAAAAATTTACCCCTGAGGG + Intergenic
1085894520 11:80622508-80622530 AGTTGGATTTTGAACCCAGATGG - Intergenic
1086259410 11:84920361-84920383 AGTTGAATCTTGACAGCTAATGG - Intronic
1087427851 11:98013087-98013109 AGGTGTCTATTGACCCCTGCTGG - Intergenic
1088337455 11:108722374-108722396 AATTGAATATTGATCATTGATGG + Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1097517241 12:60620473-60620495 AGGTGTCTGTTGACCCCTGATGG - Intergenic
1099236025 12:80083697-80083719 AGGTGTGTATTGACCCCTGCTGG + Intergenic
1099567004 12:84264281-84264303 AGTTGTATATTCACCCTTGATGG - Intergenic
1100740120 12:97582099-97582121 AGGTGTCTGTTGACCCCTGATGG - Intergenic
1103554155 12:121755846-121755868 AGTTGAGGACTGACCCCAGAGGG + Intronic
1106391085 13:29336566-29336588 AGATGTTTATTGACCCCTGCTGG + Intronic
1106441086 13:29771357-29771379 AGCTCAATATTGCCCCCTTATGG - Intronic
1108382870 13:49871047-49871069 AGTTAAATTTGAACCCCTGAGGG - Intergenic
1109285044 13:60398698-60398720 AGTTGAATGTTGAGCACAGAGGG + Intronic
1109610597 13:64760055-64760077 AGTTGAATTTTGAAGCCAGATGG + Intergenic
1112927574 13:104695585-104695607 AGATTGATATTGAGCCCTGATGG + Intergenic
1113131442 13:107042041-107042063 AGTTGTCTGTCGACCCCTGATGG + Intergenic
1113818829 13:113195878-113195900 AGTTCAAAATTGACAACTGAAGG + Intronic
1115048624 14:29028806-29028828 AGTTGTCTGTTGACCCCTGCTGG + Intergenic
1115308908 14:31959781-31959803 CATTGAATATTGACCCATTATGG - Intergenic
1117600081 14:57365630-57365652 AGGTGTCTATTGACCCCTGTTGG - Intergenic
1122362102 14:101173677-101173699 AGCAGAATAATGACCCCTAAGGG - Intergenic
1124360887 15:29035901-29035923 AGCTGAATATGGACCCCTCAGGG + Intronic
1130485177 15:84394802-84394824 AGTTGAAAAATGCCACCTGAAGG - Intergenic
1131188494 15:90294654-90294676 AGTTGAAAAATGCCACCTGAAGG - Exonic
1140811444 16:78582775-78582797 GGTGGAATAAGGACCCCTGATGG - Intronic
1143779747 17:9223076-9223098 AATTGACTGTAGACCCCTGAAGG - Intronic
1144732878 17:17538799-17538821 AGGTAAATATTGACCCAAGAAGG - Intronic
1145030527 17:19501571-19501593 ACTTGAAAACTGAACCCTGAAGG - Intronic
1156256468 18:35402234-35402256 TGTTGAATATGGACCACTGGAGG + Intergenic
927451981 2:23216579-23216601 GGTTGATTTTTGCCCCCTGAGGG + Intergenic
930969286 2:57375139-57375161 AGTAGAAAAGTGATCCCTGATGG + Intergenic
931538746 2:63305309-63305331 AGGTGTCTATTGACCCCTGCTGG - Intronic
940565075 2:155350950-155350972 AGGTGAATGTCGACCCCTGCTGG + Intergenic
940689488 2:156897604-156897626 AGTTCAATAGTGACCTCAGAAGG + Intergenic
944716668 2:202381905-202381927 AATTGAATATTGATCTCTAATGG + Intronic
944774123 2:202944649-202944671 TGTTGAATATTAACCTCTGCCGG - Intronic
1176345373 21:5739288-5739310 AACTGAATTCTGACCCCTGAGGG - Intergenic
1176352187 21:5859872-5859894 AACTGAATTCTGACCCCTGAGGG - Intergenic
1176499454 21:7585167-7585189 AACTGAATTCTGACCCCTGAGGG + Intergenic
1176539694 21:8137358-8137380 AACTGAATTCTGACCCCTGAGGG - Intergenic
1176558645 21:8320403-8320425 AACTGAATTCTGACCCCTGAGGG - Intergenic
1177959376 21:27643670-27643692 AGATGCATATTGACCAGTGATGG + Intergenic
1179804850 21:43830721-43830743 AGTTAAATATTGTTTCCTGAAGG - Intergenic
1183792782 22:40087239-40087261 AATGGAATATTGCCCCCTTATGG + Intronic
1203244643 22_KI270733v1_random:53713-53735 AACTGAATTCTGACCCCTGAGGG - Intergenic
951385616 3:22038188-22038210 AGATGAATAATGACACATGAAGG + Intronic
951647475 3:24908899-24908921 AGTTGAATATGGATAGCTGAAGG - Intergenic
951767735 3:26218446-26218468 AGCTGACTATTGACCACAGAGGG - Intergenic
957695790 3:83636429-83636451 AGGTGTGTGTTGACCCCTGATGG - Intergenic
960177361 3:114532704-114532726 AGCTGTCTATTGACCCCTGCTGG - Intronic
962124913 3:132606846-132606868 AGGTGTATGTTGACCCCTGTTGG - Intronic
962378416 3:134877464-134877486 GGTTGAATATGGAGGCCTGAGGG - Intronic
963715702 3:148801236-148801258 AGTTGAATATTGACCCCTGAGGG - Intronic
964502801 3:157366981-157367003 AGGTGAATTCTGACCACTGAGGG - Intronic
965497340 3:169414103-169414125 AGTTGTCTGTTGACCCCTGATGG - Intronic
973870613 4:55162299-55162321 AGTTGAAGATAGAACCTTGAAGG + Intergenic
979397146 4:120202479-120202501 AGAGGAATATTGACTTCTGAGGG - Intergenic
979457676 4:120944790-120944812 AGGTGTCTATTGACCCCTGCTGG - Intergenic
979864849 4:125741338-125741360 ATTTTAATACTGACTCCTGATGG + Intergenic
985473178 5:59522-59544 TGTTGGATATTGACCCCTTGTGG + Intergenic
986202836 5:5593984-5594006 TTTTGAATATTAACCCCTTATGG - Intergenic
987222965 5:15809290-15809312 AGTGGAATGGTAACCCCTGAAGG - Intronic
990849589 5:60187714-60187736 AGTTGAAAACTGACTGCTGATGG + Intronic
991086010 5:62648809-62648831 ATTTGAATATTTACCCAAGAGGG + Intergenic
992139775 5:73784008-73784030 AGTTGAATATTGCCCTCTGCTGG - Intronic
992278286 5:75144572-75144594 AGTTAATTTTTGTCCCCTGAGGG - Intronic
997248707 5:132372414-132372436 AGTTTTACATTGACCCCTGAGGG + Intronic
998136060 5:139675318-139675340 AGTTCAAGATTGAACCCTGCGGG + Intronic
1000561033 5:162789726-162789748 AATGGAATATTGCCCCCTTATGG + Intergenic
1010575015 6:77519239-77519261 AGGTGATTGTTGACCCCTGTTGG - Intergenic
1014903838 6:127002590-127002612 AGCTGAATAACGACCCCTAAAGG - Intergenic
1016418316 6:143856858-143856880 AGGTGTCTATTGACCCCTGATGG + Intronic
1028633065 7:92957106-92957128 TGTTGAATATTGGCCCATAAAGG - Intergenic
1029352282 7:100022653-100022675 GGTTGAATATTGACTCCAGTAGG + Intronic
1031132323 7:117847046-117847068 AGTTGAATATTGACTTTTGCAGG - Intronic
1033519341 7:142145234-142145256 ATTTTAAAATTGACACCTGAGGG - Intronic
1035070009 7:156137639-156137661 AGTTGGATATTGATCCTTCATGG - Intergenic
1036423275 8:8617980-8618002 AGTTGAATATTTGGCCCTCAGGG - Intergenic
1037778171 8:21849295-21849317 AGCTGAATAGGGTCCCCTGAGGG + Intergenic
1041244744 8:55879762-55879784 ATTTGCATATTGAGCCCGGAGGG - Intergenic
1048843042 8:138581690-138581712 AGCTGAATGTGGACACCTGAAGG - Intergenic
1051695740 9:19766717-19766739 AGTTGTCTGTTGACCCCTGCTGG + Intronic
1055178909 9:73358364-73358386 TGTTGATAATTGACCCCTGAGGG + Intergenic
1056293674 9:85169835-85169857 AGTTGAAAATGGACCCCTGATGG - Intergenic
1056550128 9:87645969-87645991 AGTTGGATAATGAGCCCAGAAGG - Exonic
1203460977 Un_GL000220v1:36796-36818 AACTGAATTCTGACCCCTGAGGG - Intergenic
1185783853 X:2872853-2872875 ATTTGAATACTGACCCATCAAGG - Intronic
1186587326 X:10889241-10889263 AATTGCATCTTGATCCCTGAGGG - Intergenic
1186819070 X:13267873-13267895 AATTGTATATTGAGCACTGAGGG + Intergenic
1191085056 X:56557648-56557670 AGTGGAATATTCACCCCAGGGGG - Intergenic
1192686437 X:73310783-73310805 AGTTGAAAAATGACAACTGAAGG + Intergenic
1193334723 X:80274439-80274461 AGGTGTTTATTGACCCCTGCTGG - Intergenic
1198125051 X:133635502-133635524 AGTTGTTTTTTGACACCTGAAGG - Intronic
1199704908 X:150415810-150415832 AGTTAAATATTTATCCTTGAAGG + Intronic
1202372936 Y:24210488-24210510 AGTTGAAAAATGCCACCTGAAGG + Intergenic
1202497846 Y:25459632-25459654 AGTTGAAAAATGCCACCTGAAGG - Intergenic