ID: 963716528

View in Genome Browser
Species Human (GRCh38)
Location 3:148810413-148810435
Sequence TAGGTTCTTACAGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963716524_963716528 18 Left 963716524 3:148810372-148810394 CCTCAGTGTCTCTGGTATTGTCC 0: 1
1: 0
2: 0
3: 15
4: 156
Right 963716528 3:148810413-148810435 TAGGTTCTTACAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 128
963716525_963716528 -3 Left 963716525 3:148810393-148810415 CCTGTTATTTAATGCCTTAATAG 0: 1
1: 0
2: 4
3: 18
4: 197
Right 963716528 3:148810413-148810435 TAGGTTCTTACAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963716528 Original CRISPR TAGGTTCTTACAGATGCTGC TGG Intronic
900928098 1:5718678-5718700 TAGTTTATTACAGACACTGCTGG - Intergenic
902120804 1:14163922-14163944 TTGGTCCTCACAGAAGCTGCTGG - Intergenic
906298356 1:44662846-44662868 GAGGTTCAAACAGCTGCTGCTGG + Intronic
906551783 1:46671567-46671589 CAGGTACTTACGGATGTTGCTGG - Intronic
907739535 1:57151327-57151349 TAAGGTCCTCCAGATGCTGCAGG + Intronic
907821406 1:57973428-57973450 CAATTTGTTACAGATGCTGCAGG + Intronic
909161613 1:72158112-72158134 GAGCTTCTCACATATGCTGCTGG - Intronic
919187218 1:194167853-194167875 TACTTTCTTATATATGCTGCAGG - Intergenic
920560453 1:206934783-206934805 TTGGTACTTGGAGATGCTGCAGG + Intronic
1063204264 10:3815750-3815772 TAGGTTCTTCCAGATGCCAGTGG - Intergenic
1063392933 10:5661907-5661929 GGGCTTCTTACAGAGGCTGCTGG - Intronic
1063433955 10:6015717-6015739 TATGTTCCTACAGATGATTCTGG + Intronic
1064444114 10:15378660-15378682 TAGCTTCTTACACATTCTACAGG + Intergenic
1065183401 10:23149211-23149233 TGGGAACTTTCAGATGCTGCTGG - Intergenic
1067738033 10:48873951-48873973 GTGGTTCTTACCTATGCTGCAGG + Intronic
1068121092 10:52782620-52782642 AAGATTCATACAGATTCTGCAGG - Intergenic
1069159376 10:65073576-65073598 TAGGTCCTGACAGATACTGCAGG - Intergenic
1069541226 10:69295389-69295411 TAGGTTCTTACAAATGTACCAGG - Intronic
1072426782 10:95336868-95336890 TAGCTTCTTGCAGCTGCCGCTGG - Exonic
1073233582 10:101993952-101993974 AAGGTTTTCACAGAGGCTGCAGG + Intronic
1074884321 10:117682943-117682965 GAGGTTCTTTCAGCTGCTGGGGG + Intergenic
1078230382 11:9436268-9436290 CAGGTTCTTACAGGAGTTGCAGG + Exonic
1078384942 11:10881902-10881924 TGGATTCTTACAGATGATGATGG - Intergenic
1086551174 11:88054122-88054144 TAAGTTCTTAGAGATGTGGCTGG - Intergenic
1088333029 11:108672740-108672762 TATTTTATTACAGATGCTGAAGG - Intronic
1089438200 11:118489779-118489801 TATTTTCTTACAGCAGCTGCTGG + Exonic
1096611872 12:52807348-52807370 AAGGTACTTACAGATGCTCACGG + Exonic
1097342306 12:58453139-58453161 TAGGTTCTTAAAGAAGCAGTGGG + Intergenic
1101757997 12:107636217-107636239 TAGGTTCTTTCAGAGGATCCTGG + Intronic
1105292491 13:19061755-19061777 TGGGTGCTCACAGAAGCTGCAGG - Intergenic
1105825875 13:24122607-24122629 AAGGTTCTTACAGGAGTTGCAGG - Intronic
1108319031 13:49269159-49269181 AAGGTCTCTACAGATGCTGCTGG + Intronic
1108514783 13:51190751-51190773 TATGTTTTTCCACATGCTGCTGG + Intergenic
1109360683 13:61291801-61291823 TAGGTTCTCAGAGATTCTTCAGG + Intergenic
1110593973 13:77297499-77297521 GAGGTTGTTCCAGATGCTGAAGG + Intronic
1113496253 13:110731855-110731877 TAAGTACTCACAGATGCTGGTGG - Intergenic
1117374531 14:55108482-55108504 GAGGTTCTGAAAGACGCTGCTGG + Intergenic
1118533763 14:66735219-66735241 TAGTATCTGACAGATGTTGCTGG - Intronic
1119362718 14:74064711-74064733 TATGACCTCACAGATGCTGCTGG + Exonic
1121359054 14:93239221-93239243 AAGTTTCTTAAAGATGCTGTTGG - Exonic
1124636293 15:31366925-31366947 TAGGCTATTGCAGATGCTACAGG + Intronic
1125789896 15:42357059-42357081 TAGTTACTCACAGATGGTGCTGG + Intergenic
1128461538 15:67872023-67872045 TAGTTTCCTTCACATGCTGCTGG + Intergenic
1132397495 15:101485046-101485068 TGGGAACTTTCAGATGCTGCTGG - Intronic
1137881902 16:52058184-52058206 CATGTCCTTACAGAGGCTGCAGG + Intronic
1140289549 16:73639951-73639973 TAGCCTCTTTCAGATCCTGCAGG - Intergenic
1146156050 17:30524362-30524384 TAGATTCTTTGAGATGCTGATGG + Exonic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1150575471 17:66426787-66426809 GAGGTTGTTTCAGCTGCTGCTGG + Intronic
1157473048 18:48004355-48004377 TGGGTTCTCACAGAAGCTGGAGG - Intergenic
1158841015 18:61387427-61387449 TAGGTTCTCACAGTTCCTGAGGG - Intronic
1159105170 18:63996381-63996403 TTGATTCTTACAGAGGCTACTGG + Intronic
1159178873 18:64874885-64874907 TGGGGTCACACAGATGCTGCTGG - Intergenic
1164016169 19:21257695-21257717 CAGGTTCTTCCATAGGCTGCAGG - Intronic
1164842946 19:31407765-31407787 TAGGTTGTGCCAGATGCTCCTGG + Intergenic
1165329301 19:35132486-35132508 TTGGTCATTACAGATGATGCTGG - Intronic
1166322721 19:42028597-42028619 GAGGTGCTTACAGCTGGTGCTGG - Intronic
925879232 2:8337600-8337622 TCAGTTCTTAAAGAAGCTGCTGG - Intergenic
931391534 2:61848220-61848242 TAGCTTCTGAAAGATGCGGCAGG + Intronic
932805297 2:74778041-74778063 TATGTGTTTAAAGATGCTGCAGG + Intergenic
936504153 2:113091614-113091636 GAGGTTCTTAAAGATTCTCCAGG + Intergenic
936504238 2:113092378-113092400 TTGGTTCTTACAGAGTCAGCTGG + Intergenic
941411089 2:165157949-165157971 TAGGTACTATCAGATGCTCCAGG + Intronic
941438858 2:165508188-165508210 TAAATTCTTACAGATGGTCCTGG - Intronic
942664930 2:178307354-178307376 TGGATTCTTACAGATTCTCCTGG - Intronic
1168833192 20:858672-858694 TATTTTCTTACAGTTTCTGCAGG - Intergenic
1169897574 20:10520746-10520768 TATGTTCATACAGATGGTGTTGG - Intronic
1170855175 20:20046186-20046208 TGGGTTCTCACAGGTGCTGATGG - Intronic
1174589557 20:51634519-51634541 TAGGTTCTTTCAGACTCTGCAGG - Intronic
1177595996 21:23243995-23244017 TAGTTTCTGACACATACTGCAGG - Intergenic
1179926571 21:44538365-44538387 TGGGTTCCCACAGATGATGCCGG - Intronic
1182459053 22:30471552-30471574 TAGGAGCTGAAAGATGCTGCTGG - Intronic
1184747392 22:46464365-46464387 CAGGGTCATTCAGATGCTGCGGG + Intronic
949483668 3:4517409-4517431 GAGGTTCTTGGAGAAGCTGCTGG - Intronic
952503383 3:33985551-33985573 TAAGTTTTTTGAGATGCTGCTGG + Intergenic
954436328 3:50498305-50498327 TAGGATCTTATAGATGCTGGGGG - Intronic
955366532 3:58314983-58315005 TAGTTTGTTAAAGATACTGCTGG - Intronic
956249898 3:67224879-67224901 CAGGTGGATACAGATGCTGCTGG - Intergenic
958172334 3:89953862-89953884 TATGTTCTTACAGTTGCTAATGG + Intergenic
959929890 3:111968693-111968715 TTGGTTGTAACAGATGCTGCAGG - Intronic
960906919 3:122610840-122610862 TGGGTTGTTACAACTGCTGCTGG + Intronic
962208268 3:133453784-133453806 TAAGTTCTAGCAGATGCTGATGG - Intronic
963716528 3:148810413-148810435 TAGGTTCTTACAGATGCTGCTGG + Intronic
964123455 3:153210606-153210628 TAGTTTATTTCAGATTCTGCAGG - Intergenic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
968552714 4:1231913-1231935 TGGGTTCTCACAGGTGCAGCAGG - Intronic
970277086 4:14412877-14412899 TGGGTTCTTACAGATTGTGGTGG - Intergenic
971103563 4:23497088-23497110 TAGGTACTTACAGATGAAGAAGG + Intergenic
973044531 4:45519467-45519489 TAGGTGCCAGCAGATGCTGCAGG - Intergenic
973173903 4:47179761-47179783 TTTGTTCTTACAGATGCTGAAGG - Intronic
974700660 4:65441175-65441197 TAGGTTATTAAAGGTGCTGATGG - Intronic
975538003 4:75472293-75472315 TAGATTCAAGCAGATGCTGCTGG + Intergenic
976981409 4:91235846-91235868 GAGATTCTTTCAGGTGCTGCTGG + Intronic
980686193 4:136232782-136232804 CAGGTTCTTACAGATGTGACAGG + Intergenic
980955530 4:139425024-139425046 TAAGATCTTACAAATTCTGCAGG + Intergenic
983898485 4:173106576-173106598 TAGGTTTTTTCAGATACAGCTGG - Intergenic
992435423 5:76751459-76751481 TGGGCTCTCAAAGATGCTGCAGG + Intergenic
994130727 5:96224601-96224623 TTGCTTCTTCCAGATGCTCCAGG - Intergenic
994401501 5:99285880-99285902 TATTTTCTCACAGATACTGCAGG - Intergenic
994862591 5:105217425-105217447 TAGCGTCTTTCAGATGCTGCAGG + Intergenic
996205408 5:120728990-120729012 TTTATTCTAACAGATGCTGCAGG + Intergenic
998014508 5:138721663-138721685 TAGGTTATAAAAGACGCTGCAGG - Intronic
998557731 5:143141990-143142012 AGGGTTATTACAGGTGCTGCAGG + Intronic
1002833257 6:843529-843551 TAGGTTCTTACAAGTTCTGGAGG + Intergenic
1002941324 6:1718910-1718932 TAGGTACTAAAAGATTCTGCAGG - Intronic
1003478409 6:6507073-6507095 TAGGTTCTTTCATATACTGTTGG - Intergenic
1005891281 6:30140892-30140914 TAGGATCTTACATACGCAGCTGG + Intronic
1006396780 6:33792731-33792753 GAGATTCTTGCAGATGTTGCTGG + Intergenic
1007755065 6:44094115-44094137 TGGTTTCTAACACATGCTGCAGG - Intergenic
1013687222 6:112599629-112599651 TAGGTTATGACAGATACTGTAGG + Intergenic
1016983569 6:149876609-149876631 TGGGTTCTTATAGATTCTGTGGG + Intergenic
1017304520 6:152900758-152900780 TAGGTTTTTTGATATGCTGCTGG + Intergenic
1017507606 6:155082860-155082882 GAGGTTCTGACAGATGGTGAGGG + Intronic
1019526515 7:1482891-1482913 TTGATCCTCACAGATGCTGCAGG + Intronic
1019587238 7:1812301-1812323 TAGATTCTCACAGTTGCTCCAGG + Intergenic
1021341552 7:19469320-19469342 GAGGTTCTGTCAGATGATGCTGG - Intergenic
1021910555 7:25382116-25382138 TAATTTCTTACAAATCCTGCAGG + Intergenic
1023700513 7:42888115-42888137 TTGGTACTTACAGATCCTGGAGG - Intergenic
1036015592 8:4780156-4780178 TAGGTTGTCAAAGATGCTGAAGG - Intronic
1039568170 8:38565604-38565626 TAGGTGCTTAGAGATGGTGAAGG - Intergenic
1041547818 8:59066226-59066248 TAGTTTCATACATGTGCTGCTGG + Intronic
1043335888 8:79176547-79176569 TCTGTTCTGACAGAAGCTGCAGG + Intergenic
1044058410 8:87601457-87601479 TAGCTTCTTCAAGAAGCTGCTGG - Intronic
1044898175 8:96915265-96915287 TAGGAAGTTACAGATGCTTCAGG - Intronic
1052852130 9:33384880-33384902 TGGGTTCTTACAGGAGCTCCAGG - Intronic
1056395752 9:86179868-86179890 CAGATTTTTACAGGTGCTGCAGG - Intergenic
1056589727 9:87956786-87956808 TATTTTCTTACAGATTCTCCTGG + Intergenic
1058249373 9:102672177-102672199 TATGATGTTACAGAAGCTGCAGG - Intergenic
1058358282 9:104108473-104108495 TTGGTTCTTTCAGATGCCTCAGG + Intronic
1189202919 X:39213158-39213180 CAGGTTCCTACAGGTGCTGCTGG - Intergenic
1189385093 X:40530761-40530783 TGGGTTCCCACAGAGGCTGCTGG - Intergenic
1189923555 X:45929473-45929495 TAAGTTCTTACCGATGGAGCTGG + Intergenic
1190884313 X:54517987-54518009 TATGTTCTCACAGCTGCGGCAGG + Intergenic
1198258228 X:134943956-134943978 TCTGCTCTTACAGAGGCTGCAGG - Intergenic
1199529190 X:148827859-148827881 TAGATTATTAGAAATGCTGCTGG + Intronic
1200793523 Y:7320015-7320037 TTGCTTCTTAAAGATGCTGAGGG + Intergenic