ID: 963716861

View in Genome Browser
Species Human (GRCh38)
Location 3:148812697-148812719
Sequence CTCTTTCTGTTCCCAGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2525
Summary {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963716857_963716861 9 Left 963716857 3:148812665-148812687 CCAGCCTTGTGGAACTGTAAGTC 0: 13
1: 1953
2: 5794
3: 7062
4: 7558
Right 963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG 0: 5
1: 83
2: 160
3: 868
4: 1409
963716852_963716861 28 Left 963716852 3:148812646-148812668 CCATGATTATGAGGCCTCCCCAG 0: 274
1: 5530
2: 6803
3: 4191
4: 2220
Right 963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG 0: 5
1: 83
2: 160
3: 868
4: 1409
963716855_963716861 11 Left 963716855 3:148812663-148812685 CCCCAGCCTTGTGGAACTGTAAG 0: 12
1: 1899
2: 6083
3: 7297
4: 7659
Right 963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG 0: 5
1: 83
2: 160
3: 868
4: 1409
963716856_963716861 10 Left 963716856 3:148812664-148812686 CCCAGCCTTGTGGAACTGTAAGT 0: 14
1: 2041
2: 6187
3: 7356
4: 7660
Right 963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG 0: 5
1: 83
2: 160
3: 868
4: 1409
963716858_963716861 5 Left 963716858 3:148812669-148812691 CCTTGTGGAACTGTAAGTCCAAT 0: 1298
1: 2452
2: 4016
3: 6253
4: 6129
Right 963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG 0: 5
1: 83
2: 160
3: 868
4: 1409
963716854_963716861 14 Left 963716854 3:148812660-148812682 CCTCCCCAGCCTTGTGGAACTGT 0: 37
1: 4190
2: 6883
3: 7953
4: 6372
Right 963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG 0: 5
1: 83
2: 160
3: 868
4: 1409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963716861 Original CRISPR CTCTTTCTGTTCCCAGTTTC TGG Intronic
Too many off-targets to display for this crispr