ID: 963717568

View in Genome Browser
Species Human (GRCh38)
Location 3:148821516-148821538
Sequence GGCTTGTGGTGTGCTGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963717568_963717572 8 Left 963717568 3:148821516-148821538 CCAATTACAGCACACCACAAGCC 0: 1
1: 0
2: 1
3: 8
4: 101
Right 963717572 3:148821547-148821569 ATAATTATGTCCTCCTTTAGTGG 0: 1
1: 0
2: 1
3: 7
4: 153
963717568_963717573 15 Left 963717568 3:148821516-148821538 CCAATTACAGCACACCACAAGCC 0: 1
1: 0
2: 1
3: 8
4: 101
Right 963717573 3:148821554-148821576 TGTCCTCCTTTAGTGGATATTGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963717568 Original CRISPR GGCTTGTGGTGTGCTGTAAT TGG (reversed) Intronic
903742656 1:25567268-25567290 GACATGTGCAGTGCTGTAATCGG + Exonic
904278003 1:29396642-29396664 GGCTTGTTGTGAGCAGTAAATGG + Intergenic
905951081 1:41951439-41951461 GATTTCTGGTGTGCTGAAATTGG + Intronic
907069471 1:51520616-51520638 GAGTTGTGGTTTGTTGTAATGGG - Intergenic
914457096 1:147846250-147846272 GGAAGGTGGTGTGCTGGAATAGG - Intergenic
917114355 1:171587095-171587117 GGGGAGTGGTATGCTGTAATGGG - Exonic
917336039 1:173925237-173925259 GGCTTGTGCTTTGCTGTGTTAGG + Intergenic
919344802 1:196361668-196361690 AGCTGGTGGTGTGGGGTAATAGG + Intronic
922616660 1:226964905-226964927 TGCTGGTGGTGTGCTGTCCTGGG + Intronic
1063503805 10:6579179-6579201 GGCTTGAGGTGTGCTCTCAAAGG + Intronic
1064347975 10:14549739-14549761 GGGTTTGGGTGTGCTGTGATGGG - Intronic
1064692920 10:17936332-17936354 AGCTAGTGGTGTGCTGGAGTGGG + Intergenic
1067431757 10:46249971-46249993 GGCTTGTCGCCTGCTGTAATGGG - Intergenic
1073602950 10:104864565-104864587 GCCTCTTGGTGTGCTGTGATGGG + Intronic
1074217882 10:111405527-111405549 GGCTAGTGGTGTGATGTAGTTGG + Intergenic
1078589756 11:12629743-12629765 GGCTTGTGGAATGCTGGTATGGG - Intergenic
1079457483 11:20649591-20649613 TATTTGTGGTGTGCTGGAATAGG + Intronic
1081568363 11:44274537-44274559 GGGTTGTGTTGTGTTGGAATGGG + Intronic
1090168467 11:124577053-124577075 GGCTTCAGGTATGCTCTAATTGG + Intergenic
1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG + Intronic
1101865294 12:108515687-108515709 GGCTTGGGGTGCGCTTTAATAGG - Intronic
1104118140 12:125770227-125770249 GTCTTGTGGTGTTCTGGATTTGG + Intergenic
1111562623 13:89970763-89970785 GTCTTGTGGTTGGCTGGAATAGG - Intergenic
1113922655 13:113922586-113922608 GGTCTGTGGTGCGCTGTTATGGG - Intergenic
1117609305 14:57465757-57465779 AGGCTGTGGTGTGCTGGAATCGG - Intergenic
1118391806 14:65302181-65302203 GGCTTCAGGTGTGCTCTGATAGG - Intergenic
1121726723 14:96157655-96157677 GGGTTGTGGTGTGCTGCAGGTGG - Intergenic
1129196318 15:73969328-73969350 GGCTTGGGGTGTGCCCTGATTGG + Intergenic
1129286043 15:74525815-74525837 GGATTGTGGTCTTCTGTAATTGG - Intergenic
1131483877 15:92804290-92804312 GGCTTTTGCTGTGTTGTAACAGG + Intronic
1135652201 16:24216176-24216198 GGCTGCTGGTGGGCTGTAGTGGG + Exonic
1137272958 16:46914847-46914869 TGCTGCTGGTGTGCAGTAATGGG + Intronic
1140662153 16:77198238-77198260 GGCTGGTGGTGTGGAGTACTTGG - Exonic
1142641161 17:1286646-1286668 GGCCTGTGGGGTGTTGTTATTGG + Intronic
1142641208 17:1286857-1286879 GGCCTGTGGAGTGTTGTTATTGG + Intronic
1144857645 17:18278498-18278520 GGCTTGTGGTGGGCTGATAGAGG - Intronic
1153244176 18:3057444-3057466 GGCTGGTGGACTGCTGTGATGGG - Intergenic
1155126159 18:22878209-22878231 GTCTCCTGGTGTGATGTAATAGG + Intronic
1155463688 18:26112256-26112278 GGCTTGTGGTGTGGTGTTTCTGG + Intergenic
1156013166 18:32517252-32517274 GGATTCTGTTTTGCTGTAATTGG + Intergenic
1156470199 18:37373027-37373049 GGCTTGTTGTGAGATGTAAGTGG - Intronic
1159862107 18:73661396-73661418 GGCTTCAGGTGTGCTGTGATTGG - Intergenic
930720508 2:54633268-54633290 GGCTTGGATAGTGCTGTAATAGG + Intronic
931053811 2:58444738-58444760 AGGTAGTGGTGTGCTGAAATAGG + Intergenic
936082124 2:109439481-109439503 GGGTTGGGGTCTGCTGAAATGGG - Intronic
939333018 2:140789064-140789086 AGCTTGTGGTATTCTGTTATGGG + Intronic
941947962 2:171121057-171121079 GGCTGGGGGTGTGGTGGAATGGG + Intronic
945542389 2:211105085-211105107 GGCATGTGGTGGGCTCTCATTGG + Intergenic
947773559 2:232689855-232689877 GGCTTTTTGTGTTCTGTAAGGGG + Intergenic
1169228977 20:3874515-3874537 GGCTCTGGGTGTGCTGTGATTGG + Exonic
1169280360 20:4262106-4262128 GGCTTCAGGTATGCTGTGATTGG + Intergenic
1177221712 21:18202322-18202344 GACTTCTAGTGTGCTGTATTTGG + Intronic
1178243038 21:30924343-30924365 TGCTGGTGGTGTGCTATCATTGG - Intergenic
1180123617 21:45770745-45770767 GCCTTGTGGGGTGCTGAAAGGGG + Intronic
1180185033 21:46135273-46135295 GGATGCTGGTGTGGTGTAATTGG - Intergenic
1180663520 22:17490253-17490275 GGGTTGTGGTGTCCTGTTATTGG + Intronic
1180904582 22:19400299-19400321 GGTTTGGTGTGTGCTGTATTTGG + Intronic
1185119360 22:48956799-48956821 GGTTTGTGGTGTGTTGTGAGAGG - Intergenic
952053787 3:29418879-29418901 TCCTTGTGGTTTGCAGTAATGGG - Intronic
954809985 3:53241699-53241721 GGGTGGTGGTGTGCTGTAGCAGG - Intronic
955538699 3:59951772-59951794 GGCTGGTGGGGTGATGTAACTGG - Intronic
960032204 3:113065461-113065483 GGTCTGTGGTGTGCTGTAATTGG + Intergenic
960048137 3:113216632-113216654 GCCTTGTGGTCTGATGTACTGGG + Intronic
963717568 3:148821516-148821538 GGCTTGTGGTGTGCTGTAATTGG - Intronic
965469554 3:169074016-169074038 AGGTTGTGGTGAGCTGTGATTGG - Intergenic
966650457 3:182294968-182294990 GGCCATTGGTGTGCTGGAATGGG - Intergenic
969278795 4:6155101-6155123 GTGTTGGGGTGTGCTGAAATTGG + Intronic
970759335 4:19465310-19465332 GGCTTCAGGTGTGCCCTAATTGG - Intergenic
971447681 4:26768361-26768383 GTCTTGAGGTGTGCTGATATGGG - Intergenic
972108097 4:35518897-35518919 GGGTTGTGGTGTTTTTTAATGGG + Intergenic
972121851 4:35713084-35713106 GGATAGTGTTGTCCTGTAATGGG - Intergenic
975237178 4:72013066-72013088 TGCTTCTGGTGTACTTTAATTGG - Intergenic
976721797 4:88176542-88176564 GGGCTGTAGTGTGCTGTAACTGG - Intronic
977081175 4:92530337-92530359 GCCTTGTTGTGTGATGCAATAGG + Intronic
977182207 4:93890045-93890067 GGCTTGTTGTGAGATGTAAATGG + Intergenic
986105873 5:4658898-4658920 GGCTTGAGGAGAGCTGTAACAGG + Intergenic
989678315 5:43999045-43999067 AGCTTGGGGTTTGCTATAATAGG + Intergenic
994309975 5:98258752-98258774 GGCCAGTGGTGTGCTGTCTTTGG - Intergenic
997327647 5:133035390-133035412 GGCTTGTGGGCTGCAGTAAAGGG + Intergenic
997987861 5:138518131-138518153 GGCTTGTGGTGAGCTGAGATCGG + Intronic
999238697 5:150115106-150115128 GGCTGGGGGTGTCCTGTACTTGG + Exonic
1001258065 5:170200409-170200431 GGGTTGTGGTGGCCTGTAAAGGG - Intergenic
1008416019 6:51241078-51241100 AGCTTGTGTTGGTCTGTAATGGG - Intergenic
1008473829 6:51914868-51914890 GGCTTGAGTTGTGCTTTAAAAGG - Intronic
1010320210 6:74498384-74498406 GGCTGGTGGTGTGCATTAAGAGG - Intergenic
1013154776 6:107482717-107482739 GGCTTCAGGTGTGCTCTGATTGG - Intergenic
1013221144 6:108078473-108078495 AGCTTGTGGTTTTATGTAATGGG - Intronic
1013564116 6:111340017-111340039 GGCTTGGGTAGTGCTGAAATGGG + Intronic
1018301994 6:162413094-162413116 GGCTTCTTCTGTGCAGTAATAGG + Intronic
1018943121 6:168323473-168323495 GGCTTTTCATGTGCTGTATTTGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1025622825 7:63189958-63189980 GGCTCGGGGTGTGGTGTAGTTGG - Intergenic
1028903907 7:96132080-96132102 GTTTTGTTGTGTGCTGTGATGGG + Intronic
1029080596 7:97971286-97971308 GGCTGCAGGTGAGCTGTAATTGG - Intergenic
1030110888 7:106025912-106025934 GGATGGTGGTGTACTGTACTGGG + Intronic
1031164913 7:118216268-118216290 GGCTTCTGGTTTGCTCTGATTGG - Intronic
1033395432 7:140969946-140969968 AGCTTGTGGTGTGCCGAGATGGG - Intergenic
1041432896 8:57804277-57804299 AGCTTTTAGTGTGCTGTATTGGG + Intergenic
1041529163 8:58843081-58843103 GGCTGGTAGTCTGCTTTAATGGG - Intronic
1043780445 8:84327424-84327446 AGCTTGTGGTGTGATGTAAAGGG + Intronic
1050416445 9:5422282-5422304 GCCTTGTGATGTGATGTATTAGG + Intronic
1050799047 9:9585864-9585886 GGCTTGAGGTGTGTTCTGATTGG + Intronic
1055029247 9:71756048-71756070 GGCTTGTGGTCTGCTGCAGATGG - Intronic
1055669642 9:78590008-78590030 GGGTTCTGGTGTTCAGTAATTGG - Intergenic
1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG + Intronic
1059138333 9:111828892-111828914 GGGTTGTGGGGTGATGCAATGGG - Intergenic
1186105112 X:6197198-6197220 GTCTTGTGGCCTTCTGTAATAGG - Intronic
1186981088 X:14958240-14958262 GGACTGTGCTGTGCTGTTATGGG + Intergenic
1188171833 X:26937200-26937222 AGTTTGGGGTATGCTGTAATGGG - Intergenic
1196470402 X:116017753-116017775 GGGTTCAGGTGTGCTGTATTAGG + Intergenic
1197088001 X:122502037-122502059 TGATTGGGCTGTGCTGTAATTGG - Intergenic