ID: 963721896

View in Genome Browser
Species Human (GRCh38)
Location 3:148871018-148871040
Sequence TGTAGTATAAGCTACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291796
Summary {0: 1, 1: 23, 2: 2766, 3: 73360, 4: 215646}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963721896_963721900 -2 Left 963721896 3:148871018-148871040 CCTCCCGAGTAGCTTATACTACA 0: 1
1: 23
2: 2766
3: 73360
4: 215646
Right 963721900 3:148871039-148871061 CAGGCACCTGCCACCATGCCTGG 0: 2686
1: 14968
2: 43979
3: 91398
4: 141644
963721896_963721905 26 Left 963721896 3:148871018-148871040 CCTCCCGAGTAGCTTATACTACA 0: 1
1: 23
2: 2766
3: 73360
4: 215646
Right 963721905 3:148871067-148871089 TTTTGTATTTTTAGTAAAGACGG 0: 4804
1: 204017
2: 138856
3: 62551
4: 38642
963721896_963721907 28 Left 963721896 3:148871018-148871040 CCTCCCGAGTAGCTTATACTACA 0: 1
1: 23
2: 2766
3: 73360
4: 215646
Right 963721907 3:148871069-148871091 TTGTATTTTTAGTAAAGACGGGG 0: 2220
1: 106635
2: 222607
3: 147977
4: 77177
963721896_963721906 27 Left 963721896 3:148871018-148871040 CCTCCCGAGTAGCTTATACTACA 0: 1
1: 23
2: 2766
3: 73360
4: 215646
Right 963721906 3:148871068-148871090 TTTGTATTTTTAGTAAAGACGGG 0: 4282
1: 174594
2: 210485
3: 120972
4: 65351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963721896 Original CRISPR TGTAGTATAAGCTACTCGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr