ID: 963729454

View in Genome Browser
Species Human (GRCh38)
Location 3:148957363-148957385
Sequence TAACTTCCACACATAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963729451_963729454 16 Left 963729451 3:148957324-148957346 CCAGTAGACAAAGTAGAGGAACA No data
Right 963729454 3:148957363-148957385 TAACTTCCACACATAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963729454 Original CRISPR TAACTTCCACACATAGAGCA GGG Intergenic
No off target data available for this crispr