ID: 963734047

View in Genome Browser
Species Human (GRCh38)
Location 3:148999846-148999868
Sequence CTGACTATGGGGGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 329}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963734047_963734055 -10 Left 963734047 3:148999846-148999868 CCCTCCACCACCCCCATAGTCAG 0: 1
1: 0
2: 0
3: 29
4: 329
Right 963734055 3:148999859-148999881 CCATAGTCAGTTTTAAGTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963734047 Original CRISPR CTGACTATGGGGGTGGTGGA GGG (reversed) Intronic
900478539 1:2887402-2887424 CTGAGGATGGGGGTCGGGGAAGG + Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900998666 1:6136479-6136501 CTGGCTAGGGAGGTGGTGGTGGG - Intronic
901638274 1:10680310-10680332 CCGGCTCTGGGGGTGGAGGAAGG + Intronic
902255662 1:15187194-15187216 CTGACTCGGGGAGGGGTGGATGG - Intronic
902733789 1:18386769-18386791 CAGACAATGGGGCTGGAGGAAGG + Intergenic
903852216 1:26314913-26314935 CTAATTTTTGGGGTGGTGGAGGG - Intronic
904470628 1:30733836-30733858 CTGAGTATGGGGGTGGTGCTGGG + Exonic
904595887 1:31645003-31645025 GTGACGATGGGGGCGGTGGGCGG + Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
905181638 1:36171026-36171048 CTGACATTGGTGGTGGTGGGGGG - Exonic
905224791 1:36472127-36472149 CTGACAGTGGGGGCTGTGGATGG + Exonic
905381137 1:37562375-37562397 CTGACTTTGGTGGTGGGAGAAGG + Intronic
905642206 1:39598210-39598232 CTGAGTGTGGAGGTGGGGGAGGG - Intergenic
905915773 1:41683295-41683317 CCCACTTTGGGGTTGGTGGAAGG - Intronic
906116707 1:43361809-43361831 CTGAATGTGGGGGGAGTGGAAGG - Intronic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906244031 1:44260741-44260763 CTGACTCTTGGGGTGGGGGTGGG - Intronic
906533005 1:46534127-46534149 CTGAATAAGGGGGTGGGGGTGGG - Intergenic
906688512 1:47777884-47777906 CAGACTGTGGGGGTGGGGGTTGG + Intronic
910380433 1:86621406-86621428 CTGATGATGGTGGTGGTGGTGGG - Intergenic
912507004 1:110163308-110163330 CTGACCATGGGAGTGGAGGTGGG - Intronic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
917927089 1:179798461-179798483 CTGAGTATGCGCGTGGTGGCAGG - Intronic
918015820 1:180631942-180631964 CTGACGAAGGGGGTGCTGTAAGG - Intergenic
923812754 1:237338039-237338061 CTGGCTTTGAGGGTGGAGGATGG - Intronic
923956952 1:239032941-239032963 CTGAAAATGGGGTGGGTGGAAGG + Intergenic
1063367509 10:5500026-5500048 CTGAGGCTGGGGCTGGTGGAAGG + Intergenic
1063455483 10:6179574-6179596 CTGTCCATGGGGGTCGTCGAAGG + Intronic
1064608519 10:17071495-17071517 TTGGCTTTGGGGCTGGTGGATGG + Exonic
1065123806 10:22553703-22553725 ATGACGATGGGGGTGGTGATGGG - Intronic
1067027104 10:42852788-42852810 CTCAGTATGGTGCTGGTGGAGGG - Intergenic
1070890937 10:79941856-79941878 CTGCCTTTGTGGGTGGTGGAGGG + Intronic
1071126377 10:82340115-82340137 AAGAATATGGGGGTGGTGGTTGG + Intronic
1072355327 10:94604458-94604480 CAGACTATGTGGGGGGTGGCGGG - Intronic
1072620861 10:97078363-97078385 TTAACTCTGGTGGTGGTGGAGGG - Intronic
1072955226 10:99882203-99882225 CAGAGGCTGGGGGTGGTGGAAGG + Intronic
1075192401 10:120321825-120321847 CTGACTATGAGGATGGAAGAAGG + Intergenic
1075311796 10:121420501-121420523 CAGGCTCTGGGGGTGGAGGAAGG - Intergenic
1075447233 10:122521560-122521582 CTGACAATGGTGGTGGGTGAGGG - Intergenic
1076326418 10:129626856-129626878 CTGACTATGGAGCTGGTGTAAGG + Intronic
1076767722 10:132645779-132645801 CAGGCTGTGGGGGCGGTGGAGGG + Intronic
1077108845 11:853370-853392 CTGACCATGGGTGTGGAGGGGGG - Intronic
1079103458 11:17555935-17555957 CTGACACTGGTGGTGGTGGATGG + Intronic
1081811603 11:45917429-45917451 CGGGCTCTGGGGGTGGGGGATGG - Intronic
1082802122 11:57422752-57422774 CTGAATGTGGAGGTGGTGGCTGG - Intronic
1084857284 11:71997361-71997383 CTGACAACGGGAGTGGTGGGTGG + Exonic
1084974674 11:72790214-72790236 ATGACTATGAGGGTAGTGGGGGG + Intronic
1086061219 11:82701785-82701807 GTGACAAAGGGGGTGGAGGATGG - Intergenic
1086154096 11:83646760-83646782 CTTAAGATGGGGGTGGGGGAGGG + Intronic
1086166290 11:83782710-83782732 CTGATACTGTGGGTGGTGGAGGG + Intronic
1086761183 11:90633823-90633845 ATGAAAATGGGGGTGGTGGGGGG - Intergenic
1088188194 11:107197155-107197177 CTGACAAAGGGGGTTGTGGAGGG - Intergenic
1088223625 11:107594118-107594140 GTGTTTATGGTGGTGGTGGAGGG + Intronic
1088625022 11:111723832-111723854 CTGGCTGTCGTGGTGGTGGAGGG - Exonic
1088697606 11:112381811-112381833 CTGACTCTGGGGCGGGTGGTGGG + Intergenic
1089759429 11:120712188-120712210 CTGCCCTTGGGGGTAGTGGAAGG + Intronic
1089977172 11:122742633-122742655 CTGACCAAGGGGGTTCTGGAGGG - Intronic
1090078035 11:123591691-123591713 CCGCCTTTGGGGGTGGAGGAGGG + Intronic
1090660498 11:128878695-128878717 ATGACTGAGGGGGTGGTGGGTGG - Intergenic
1092345541 12:7711682-7711704 CTGACTATAGGGGGGTTGGGAGG + Intronic
1092945767 12:13452731-13452753 CTGACTATGTGGATGGAGTATGG + Intergenic
1096196471 12:49651933-49651955 CTGGTAATGGGGGAGGTGGAGGG + Exonic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1098281901 12:68870502-68870524 GTGAGTATGGGTGTGGTGGATGG + Intronic
1098440533 12:70512716-70512738 TGGACTTGGGGGGTGGTGGAAGG + Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1100824781 12:98464429-98464451 CTGAGTGTGGGGGTGGGGGTGGG - Intergenic
1100868546 12:98885656-98885678 CGGGCAAGGGGGGTGGTGGAGGG - Intronic
1101793922 12:107955676-107955698 TTGAATATGAGGGTGGAGGATGG + Intergenic
1103917347 12:124382748-124382770 CTGAATATGGGGCTGCTGAATGG + Intronic
1103948466 12:124539698-124539720 CTGACAAGGGGGGTGCTGGCAGG - Intronic
1104500588 12:129281940-129281962 CTCCCTGTGGGGTTGGTGGAGGG + Intronic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1108645995 13:52429124-52429146 TTGACTATAGGTGTGGTAGAGGG - Intronic
1108709215 13:53016544-53016566 CTGACTGTGAAGGTGGAGGAAGG + Intergenic
1109118669 13:58425657-58425679 CTGAGTGTGGTGGTGGTGGCGGG - Intergenic
1109127083 13:58530925-58530947 CAGAATGTGGGGGTGGTGGGGGG - Intergenic
1110034726 13:70668874-70668896 ATGAGAATGGGGGTGGGGGAAGG - Intergenic
1112254746 13:97819640-97819662 TTGTCAATGGGGGTGCTGGAGGG + Intergenic
1113966349 13:114155677-114155699 CTGAGTGTGGGGGTGGAGGGTGG + Intergenic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1115819191 14:37195956-37195978 TTGGTTATGGTGGTGGTGGAGGG + Intergenic
1116498073 14:45586860-45586882 TTTGCCATGGGGGTGGTGGAGGG + Intergenic
1117010255 14:51463815-51463837 CTGTTTTTGGGGGTGATGGAGGG + Intergenic
1118456805 14:65952105-65952127 CCCTCTGTGGGGGTGGTGGAGGG + Intergenic
1120860075 14:89247074-89247096 CTGACTATTGGGTGGGTGGGTGG - Intronic
1120935984 14:89895723-89895745 CTGACTTTGGGGGTAATGAAGGG + Intronic
1121432933 14:93900196-93900218 CTGGGAGTGGGGGTGGTGGACGG + Intergenic
1121720044 14:96102928-96102950 TTGGCTATGGTGGTGGGGGATGG + Intergenic
1122352425 14:101103788-101103810 CTGCCTCTGGGGGAGGCGGAGGG - Intergenic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1123426727 15:20177308-20177330 CTCAGTATGGTGCTGGTGGAGGG - Intergenic
1123535958 15:21183835-21183857 CTCAGTATGGTGCTGGTGGAGGG - Intergenic
1124347548 15:28932579-28932601 CTGACAGTGGAGATGGTGGACGG + Intronic
1126435501 15:48633445-48633467 GTGAGTATGTGTGTGGTGGAGGG + Intronic
1126615429 15:50574048-50574070 CTCCCTCTGGGGGTGGGGGAGGG + Intronic
1127587967 15:60396597-60396619 CTGATTATGGGATTGGTGGTGGG - Intronic
1128115241 15:65101198-65101220 CTGACTGTGGGGCTGCTGGGGGG + Intronic
1128145564 15:65330718-65330740 CTGACAGTGGGGGTGGGGCAGGG + Exonic
1128236417 15:66070556-66070578 CTGGCTCTGGTGGTGGTGGGGGG + Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG + Intronic
1130095303 15:80851147-80851169 GTGACTATGTGGGAGGGGGAGGG + Intronic
1130380350 15:83366588-83366610 CTGGGGATGGGGGTGGTGGCGGG + Intergenic
1131414760 15:92244961-92244983 AGGACTAAGGGGTTGGTGGAAGG - Intergenic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132265893 15:100470405-100470427 CTGACTGTGGGGTTGGCAGAGGG + Intronic
1133435653 16:5777256-5777278 CTGACTATGAAGGTAGAGGAAGG - Intergenic
1133970543 16:10564689-10564711 CTGAGAATGGTGGTGGTGGATGG - Intronic
1134027533 16:10965811-10965833 ATGACTCTGTGGGTGGTGGGGGG - Intronic
1134240576 16:12503098-12503120 CTGGGGGTGGGGGTGGTGGATGG - Intronic
1136316917 16:29459918-29459940 CTGAGTATGGGTGTGGTGTAGGG - Exonic
1136431492 16:30199260-30199282 CTGAGTATGGGTGTGGTGTAGGG - Intronic
1136857522 16:33672197-33672219 CTCAGTATGGTGCTGGTGGAGGG + Intergenic
1137367518 16:47873606-47873628 CTGCTGATGTGGGTGGTGGAGGG - Intergenic
1137661460 16:50210388-50210410 CTGACTATCATGGTGGTGGGGGG - Intronic
1138196451 16:55055691-55055713 GTGACTCTGGGGTTGGTGGAGGG - Intergenic
1138251716 16:55506855-55506877 GTGGTTTTGGGGGTGGTGGAGGG - Intergenic
1138734889 16:59238889-59238911 CTGACTATTTGAGGGGTGGACGG + Intergenic
1141118847 16:81335139-81335161 GTGACTATGGGGTGGGGGGAGGG + Intronic
1142175721 16:88644023-88644045 CTGCACATGGGGGTGGTGGGGGG + Intronic
1142294915 16:89214493-89214515 CAGAGGATGGGGTTGGTGGAAGG + Intergenic
1203119095 16_KI270728v1_random:1520682-1520704 CTCAGTATGGTGCTGGTGGAGGG + Intergenic
1142749500 17:1978626-1978648 CGGAAAATGGGGGGGGTGGAGGG + Intronic
1142782213 17:2190125-2190147 CTGCCTATGGGGAGGGTGAAGGG - Intronic
1143107811 17:4538236-4538258 CTGGCTTGGGGGGTGGTGGCAGG - Exonic
1144472797 17:15559759-15559781 CTGACTGGGGAGGTGGAGGAAGG + Intronic
1144923682 17:18784946-18784968 CTGACTGGGGAGGTGGAGGAAGG - Intronic
1145294708 17:21578926-21578948 CTGGCTATGGGGTGGGTGGGAGG + Intergenic
1146254837 17:31385755-31385777 ATGGCAGTGGGGGTGGTGGAGGG + Intergenic
1146330009 17:31918936-31918958 CTGACAAAGGGTGTGGTGAAGGG + Intergenic
1146634323 17:34492847-34492869 CTGAAGATGGGGGTGGAGAATGG + Intergenic
1147363674 17:39946617-39946639 CCGACCAAAGGGGTGGTGGAGGG - Intergenic
1148470699 17:47891413-47891435 CTGTCTGTCGGGGGGGTGGAGGG - Intergenic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1151323726 17:73366400-73366422 CAGACCCTGGGGGTAGTGGAGGG + Intronic
1151705635 17:75765509-75765531 CTGGCTGTGTGGGTGGTGGTGGG - Exonic
1153320161 18:3765043-3765065 CTGTTTATGTAGGTGGTGGATGG + Intronic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1157137560 18:45071625-45071647 CTGACTATAATGGTGGTGGTAGG - Intergenic
1157260106 18:46170008-46170030 CTGGCTATGGTGGGGGTGGGTGG + Intergenic
1157460391 18:47887105-47887127 ATGACTAGAGTGGTGGTGGAAGG - Intronic
1157489929 18:48116124-48116146 CTGTCCTTGGGGGTGGGGGACGG - Intronic
1157816343 18:50731920-50731942 CTGTATTTGGGGGTGGGGGAAGG + Intergenic
1159904977 18:74081686-74081708 CTGAGTATGGTGGAGTTGGAGGG - Intronic
1160396038 18:78572836-78572858 CTGACTTTGGAGGTGGAAGAGGG + Intergenic
1160958831 19:1708187-1708209 CTGGCTGTGGAGGTGGAGGAAGG - Intergenic
1161429678 19:4224348-4224370 TGGTCTATGGGAGTGGTGGAGGG + Intronic
1162898165 19:13777906-13777928 CTGACTGTGGGTCTGGTGGCTGG - Intronic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165342720 19:35224366-35224388 CTGACTTGGGGAGTGGTGGCTGG + Intergenic
1165463338 19:35957895-35957917 CTAAGTATGGGGGTGCTGGGTGG - Intergenic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166758665 19:45211352-45211374 CTGGGTATGGTGGTGGTGGAGGG + Intronic
1166771744 19:45287578-45287600 CTGACCATGGGGCTGGAGGGGGG - Exonic
1167412995 19:49355971-49355993 CTGCCCGTGGGGGTGGGGGAGGG + Intronic
1167490502 19:49790231-49790253 CTGCCTTTGGGGATGGGGGAAGG - Intronic
925230669 2:2231007-2231029 CTGAGTCTGGGGGTGGGGGCTGG - Intronic
925254878 2:2474901-2474923 CTGAGCATGGGGGTGGGGGTGGG - Intergenic
925340106 2:3130315-3130337 CTGGCTTTGGTGGTGGAGGAAGG - Intergenic
926321083 2:11748774-11748796 CTGCCAATGGGGGTAGTCGAGGG + Intronic
927435639 2:23064019-23064041 CTGACTGTGGTGGTGGTGGTGGG - Intergenic
928123762 2:28602359-28602381 CAGAAGATGGTGGTGGTGGAGGG - Intronic
928125974 2:28616510-28616532 CTGATTTTGGGTGTGGTGCATGG + Intronic
929695741 2:44113754-44113776 TTGAATATGGCAGTGGTGGAAGG - Intergenic
930027972 2:47041078-47041100 CTGACTGGGGTGGGGGTGGAGGG - Intronic
930506494 2:52287996-52288018 TTGACAATGGGGATGGTGGAAGG - Intergenic
931638153 2:64359079-64359101 GGGACTCTGGGGGTGGTGGCTGG + Intergenic
931906064 2:66845369-66845391 CTGCCAATGAGTGTGGTGGAAGG + Intergenic
932004516 2:67914931-67914953 CTGACTTTGAGAGTGGTAGAGGG + Intergenic
932454462 2:71838839-71838861 CTTGCTTTGGGGGTGGAGGAGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935569286 2:104642082-104642104 GTGGCTATGGGGCTGTTGGAGGG + Intergenic
935668454 2:105534970-105534992 CTGATTATGGATGAGGTGGAGGG - Intergenic
935763945 2:106345785-106345807 CTGACTTTGGGGGTGGGGCAAGG + Intergenic
936072521 2:109380785-109380807 CTGCCTATGCAGGTGGTGGGGGG - Intronic
936377438 2:111954021-111954043 CTCACTATGGTGGTGGGGTAGGG - Intronic
936899900 2:117470697-117470719 CTCACTGTGGTGGTGGTGGGTGG + Intergenic
937015541 2:118602098-118602120 CTGTCTGTGAGGGTGGAGGAAGG + Intergenic
937305171 2:120866590-120866612 CTGCTAATGGGGGTGGGGGATGG - Intronic
937336752 2:121066938-121066960 GTGGCTTTGTGGGTGGTGGATGG + Intergenic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
939548659 2:143586137-143586159 CTAACCAAGGGGGTGGTGGTGGG - Intronic
942344976 2:174993229-174993251 CAGGTTGTGGGGGTGGTGGATGG - Intronic
943556207 2:189407322-189407344 AAGAATATGGGGGAGGTGGAGGG + Intergenic
943680543 2:190762446-190762468 GTGATGATGGAGGTGGTGGAAGG + Intergenic
947753212 2:232543474-232543496 TTGAGGATGGGGGGGGTGGATGG - Intronic
947969379 2:234309623-234309645 CGAACTATGGGGGTGGGGGGCGG - Intergenic
947981119 2:234410565-234410587 TGGACTCTGAGGGTGGTGGAGGG - Intergenic
948630768 2:239301159-239301181 CTGAGTAAGGGGGTGGTGCCCGG - Intronic
1169756754 20:9051147-9051169 CTGGCTTTGGTGGTGGAGGAAGG + Intergenic
1170665347 20:18381563-18381585 GTGACCATGAGGGTGGAGGAGGG + Intergenic
1171345366 20:24461926-24461948 GTGACCCTGGGGGTGGGGGAAGG - Intergenic
1172486087 20:35298563-35298585 CTGGCTTTGGAGGTGGTGAAGGG - Intergenic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1173403859 20:42748229-42748251 TTGACAATAGAGGTGGTGGAAGG + Intronic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1175764162 20:61581539-61581561 CTGACCATGAGGGTGGAGGAGGG - Intronic
1176247832 20:64105675-64105697 GTGATGATGGGGGTGGTGGTGGG + Intergenic
1176521329 21:7826792-7826814 CTGACTCTGGGGATAGGGGAAGG - Intronic
1178032712 21:28546065-28546087 ATGACTTTCAGGGTGGTGGATGG + Intergenic
1178655349 21:34456804-34456826 CTGACTCTGGGGATAGGGGAAGG - Intergenic
1178894560 21:36548179-36548201 CTTACTAGGGGAGTGGAGGAAGG - Intronic
1179188989 21:39107483-39107505 CTGAGTGTGGAGGTGATGGATGG + Intergenic
1179449829 21:41460838-41460860 CTGATTTGGGTGGTGGTGGAAGG - Intergenic
1179583540 21:42360535-42360557 CTGCCTTTGGGTGTTGTGGAAGG - Intergenic
1179793414 21:43768564-43768586 CTGACTGTGGGGGTGGGGAGGGG - Intergenic
1180880230 22:19198276-19198298 CTGACTAGGGTGGTGGTGACAGG - Intronic
1181557906 22:23682626-23682648 CTGACTCTGAGGGTGGCTGAGGG - Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183276971 22:36904565-36904587 CTGACTAGGGGGTTGCAGGAGGG + Intergenic
1183458166 22:37933918-37933940 CAGACTGTGGGGATGGTGGCAGG + Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184135000 22:42542893-42542915 CTGAATTTGGGGGGGGTGGGGGG + Intergenic
1184322783 22:43755716-43755738 CTGACAATGGGTGGGGTGGGGGG + Intronic
1184818837 22:46893427-46893449 CTGACAATGGGGATGATGGCAGG + Intronic
1185063747 22:48620661-48620683 ATGGATGTGGGGGTGGTGGATGG - Intronic
1185366433 22:50439036-50439058 CTGACTGTGTGGGGGCTGGACGG - Intronic
949782794 3:7709037-7709059 TTGACTACAGAGGTGGTGGAAGG - Intronic
951617155 3:24560175-24560197 CTCATTATGGAGGTGGGGGAGGG - Intergenic
954111640 3:48436871-48436893 CAGAACATGGGGGTGGGGGACGG - Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954334527 3:49908611-49908633 CTGAATATGGGGGTGGGGGTAGG + Intronic
954408482 3:50358807-50358829 CTGACAACGGTGGTGGTGGCCGG - Exonic
954434445 3:50488629-50488651 CTTGCTAGGGGGGTGGTAGAGGG - Intronic
954452747 3:50580456-50580478 CTGACCAGAGGGGAGGTGGATGG + Exonic
954662790 3:52234959-52234981 CTGCCTCTGTGGGTGGGGGAAGG - Intronic
954757362 3:52848586-52848608 CTGTTTGTGGGGGTGGTGGGAGG + Intronic
955073144 3:55588568-55588590 CTGACTGTGGTGCTGATGGATGG - Intronic
957851391 3:85812125-85812147 CTATATATGGGTGTGGTGGAAGG + Intronic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
960255172 3:115504002-115504024 CAGAAAATGGGGGTGGTGGATGG - Intergenic
960485850 3:118252002-118252024 CTTACTAAGAGAGTGGTGGAGGG - Intergenic
961239685 3:125399890-125399912 CTGATTTTGTGGGTGGTTGATGG - Intergenic
962438731 3:135392196-135392218 CTGACTGTGTGGGATGTGGAAGG + Intergenic
962595893 3:136943029-136943051 CTGACTTGGGGTGTGGGGGATGG + Intronic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
964995554 3:162874779-162874801 CTCAGGATGGGGGTGGTGGATGG - Intergenic
966042697 3:175510820-175510842 CTGACTTTAGGGGTGATGAAAGG - Intronic
966891687 3:184411827-184411849 CTGACTGTGGGGGTGAAGGACGG - Intronic
967597870 3:191349078-191349100 CTGCTGATGGGGGTGGAGGAGGG + Intronic
968598086 4:1495670-1495692 CTGACCTCGGGGGCGGTGGAGGG - Intergenic
969037853 4:4269653-4269675 ATGACTTTGGTGGTTGTGGAGGG - Intronic
970828079 4:20302460-20302482 ATGTCTATGGGGGGGATGGAAGG + Intronic
972233275 4:37099849-37099871 CTGACTATGAAGGTGGAGGAAGG + Intergenic
974421542 4:61683038-61683060 TTGACTAGGGTGGTGGTGGTGGG + Intronic
974985718 4:69024085-69024107 CTGAATATCGGGGGGGTGGGGGG - Intronic
975131409 4:70836266-70836288 CATACTCAGGGGGTGGTGGAAGG + Exonic
976465273 4:85360806-85360828 CTGAGCAGGGTGGTGGTGGAAGG + Intergenic
979708300 4:123747600-123747622 CTGCATATGGTGGTGCTGGAAGG + Intergenic
979799044 4:124884373-124884395 TTGGCTGTGGGGGTGGTGGGGGG - Intergenic
980782718 4:137512588-137512610 CTGATTGTGGGGGTGGGGGTTGG - Intergenic
985187756 4:187335872-187335894 CTGACCTTGGGGGTGGTTCAAGG + Intergenic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986734506 5:10658956-10658978 CTAAGGATGGGGGTGGTGGGTGG + Intergenic
988662926 5:33293308-33293330 CTGCTGATGGTGGTGGTGGAGGG - Intergenic
988675360 5:33427850-33427872 CTGGCTATGGGAGGGGAGGATGG + Intergenic
988694292 5:33604542-33604564 CTAAGTAGGGGGGTGGTGGGGGG - Intronic
990073676 5:51816446-51816468 CTGACAGTGAGGGTGGAGGATGG + Intergenic
991774064 5:70067401-70067423 CTGGCATGGGGGGTGGTGGAGGG - Exonic
991853358 5:70942825-70942847 CTGGCATGGGGGGTGGTGGAGGG - Exonic
996357676 5:122615003-122615025 CAGGCTGTGGGGGTGGTGGGGGG - Intergenic
997975801 5:138440612-138440634 CTGGCTCTGAGGGAGGTGGAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998403361 5:141859721-141859743 GTGGCAATGGGGGTGATGGATGG - Intronic
1000378124 5:160603066-160603088 CTGACTCAGGGGGTGGTGAAAGG - Intronic
1000439197 5:161247200-161247222 CTGAGAATGGGGGTGGGGGGTGG - Intergenic
1001669518 5:173462270-173462292 CAGACTCTGGGGGTGGGCGATGG + Intergenic
1002691931 5:181055874-181055896 CTGGCTATGTGGGTGGTGGGGGG + Intronic
1004373424 6:15072255-15072277 TTCACTATGGGGATGTTGGAGGG + Intergenic
1005103970 6:22203387-22203409 CAGACCACGGGGGTGGTGGAGGG - Intergenic
1006091051 6:31629252-31629274 CTGACTAGGGGGCTGGCGGGTGG - Exonic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1011098326 6:83692688-83692710 AGGACCTTGGGGGTGGTGGAAGG - Intronic
1011259185 6:85453843-85453865 TTGTCTATGTGGGAGGTGGAGGG - Intronic
1011418817 6:87151646-87151668 CAGACTCTGGGGGTGGGGGTGGG + Intergenic
1012018197 6:93880444-93880466 CTGCATCTGAGGGTGGTGGATGG + Intergenic
1012973536 6:105756093-105756115 CTCACCGTGGGGGTGGAGGAGGG + Intergenic
1013440674 6:110163574-110163596 ATGAATTTGGGGGTGGGGGATGG + Intronic
1014920597 6:127211045-127211067 CTGACTTTGGGGGTTGGGGGCGG - Intergenic
1015497065 6:133893184-133893206 CGGCCTGTGGGGTTGGTGGAAGG - Exonic
1016599617 6:145843061-145843083 CTGACTATGGGATTGGAGGCAGG - Intergenic
1017721071 6:157243579-157243601 GTGATTATGGCGGTGGTGGTGGG - Intergenic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1020459296 7:8410590-8410612 CTGACTCTAGGGGTGGGGCAGGG + Intergenic
1021941032 7:25679188-25679210 CTGACAATGTGTGTGGTGGCAGG - Intergenic
1023669542 7:42561324-42561346 CTGAGGATGGAGGTGGTGGTTGG - Intergenic
1024043134 7:45570268-45570290 CAGATCATGGGGGTGGTGCAGGG - Intergenic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026461045 7:70615349-70615371 CTGGCAATGGGTGTGCTGGAAGG - Intronic
1026481275 7:70781703-70781725 CAGGTCATGGGGGTGGTGGATGG - Exonic
1026654934 7:72248451-72248473 CTGACTTTGAAGATGGTGGAAGG - Intronic
1026785397 7:73298972-73298994 CTGAATATGGGGGTGGGGTGGGG + Intergenic
1026836362 7:73642213-73642235 TAGAGTATGGGGGTGGTGCACGG + Intergenic
1027108677 7:75420961-75420983 CTGAATATGGGGGTGGGGTGGGG - Intronic
1027631243 7:80608911-80608933 CTGGCTATGGGGGTGGGGGTGGG - Intronic
1030185643 7:106759078-106759100 GTGACAAAGGGGGTGGTGTAAGG - Intergenic
1031408107 7:121409667-121409689 CTGCCAATAGAGGTGGTGGAGGG - Intergenic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1032464889 7:132137907-132137929 ATGAGTATGAGGATGGTGGAAGG + Intronic
1034393929 7:150805654-150805676 CTGAGTATGTGGGTGGTTGTGGG - Intergenic
1034468752 7:151244981-151245003 CTGACCATGGGGGTGGAGCTTGG - Intronic
1034930975 7:155163933-155163955 CTGGCTCTGGTGGAGGTGGAAGG - Intergenic
1035425250 7:158766911-158766933 CTGACTATGGAAGGGGTGGGTGG - Intronic
1035564302 8:631038-631060 CTGTCAATGTGGGTGGTGGGTGG - Intronic
1035898493 8:3431849-3431871 CTCACTGTGGGCGTGGTGGCAGG - Intronic
1036701629 8:11016880-11016902 CTGAAGATCTGGGTGGTGGAGGG - Intronic
1039891985 8:41692026-41692048 CTGAGTATGGTGGTGGGGGCAGG - Intronic
1041134991 8:54748707-54748729 CTGATACTGGGGATGGTGGATGG - Intergenic
1042058883 8:64795744-64795766 GTGACTGTGGGGTTGATGGAAGG - Intronic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1045338841 8:101233640-101233662 CAGACACTGGGGGTGGAGGAGGG + Intergenic
1045445356 8:102256769-102256791 CTTATTTTGGGGGTGGTGGAGGG - Intronic
1047165807 8:122437287-122437309 TTGATTATGGAGGTGGGGGAGGG - Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1049097890 8:140559562-140559584 ATGACTGTGGGGCTGCTGGACGG + Intronic
1049575287 8:143386985-143387007 GTGACCTCGGGGGTGGTGGAAGG - Intergenic
1050692795 9:8247502-8247524 ATGACTCTGGGGGTGGGGGGGGG - Intergenic
1051238127 9:15023468-15023490 CTGAGGATGGGGGTGGGGGTTGG - Intergenic
1051566889 9:18509742-18509764 CTGACTCTGGACTTGGTGGATGG - Intronic
1051782335 9:20703174-20703196 GAGGCTATGGGGGTGGTGGGGGG + Intronic
1053652752 9:40185827-40185849 CTAACTATGAGGTTAGTGGAGGG + Intergenic
1053903156 9:42815134-42815156 CTAACTATGAGGTTAGTGGAGGG + Intergenic
1054531829 9:66190394-66190416 CTAACTATGAGGTTAGTGGAGGG - Intergenic
1054880827 9:70142902-70142924 TTGACCATGGGGATGGTGGGAGG + Intronic
1055108212 9:72534296-72534318 CTGACTATGGTTGTGGGGTAGGG + Intronic
1056194330 9:84214772-84214794 CTGACTTTGAGGGTGGAGGAAGG - Intergenic
1057189044 9:93075996-93076018 GTGGCTCTGGGGGTGGGGGATGG + Intronic
1057524301 9:95785260-95785282 CTGACCATGTGGGTTGTAGAAGG + Intergenic
1060196661 9:121628458-121628480 CTGGCTATGGGTGTGGTGGTTGG + Intronic
1061397028 9:130348922-130348944 CTGATGCTGGGGGTGGTGGCTGG + Intronic
1061492627 9:130954490-130954512 CTGGCTAAGGGTGTGGTGGTGGG - Intergenic
1061671409 9:132190520-132190542 CTGACTAAGGAGGCCGTGGAGGG - Intronic
1061894850 9:133641867-133641889 GTGACCTTGGGGTTGGTGGAGGG + Intronic
1062132719 9:134908626-134908648 CTGGCTTTGGGGTTGGGGGAAGG + Intronic
1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG + Intronic
1062708807 9:137960394-137960416 CTGACTGGGGGGGAGGGGGAGGG + Intronic
1185741580 X:2537279-2537301 CTGAATGTGGTGGTGGTGGCTGG - Intergenic
1186389088 X:9140522-9140544 TTGACTGTGGAGGTGGTGGAAGG - Intronic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1188115804 X:26240740-26240762 TTGACTATGTGTGTGTTGGAAGG - Intergenic
1190260615 X:48794551-48794573 CTGACGGTGGGGGTGGTGCCGGG + Intergenic
1190713492 X:53085590-53085612 CTGAGTATAGGGTTGGTGGGAGG - Intronic
1191714561 X:64185445-64185467 CTGTATATGGGGGTGGGGGTGGG - Exonic
1192783982 X:74320437-74320459 CTATGTATGGGGGTGGTGGTGGG - Intergenic
1195494196 X:105510721-105510743 CTGACTTTGAAGATGGTGGAAGG + Intronic
1196126298 X:112103418-112103440 TTGGCTATGGGGGTGGAGGGAGG + Intergenic
1197728786 X:129793596-129793618 CAGAATATGGGGGTGGAGGTAGG - Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1199011164 X:142760449-142760471 ATGACCATGGGGGTGTTGGTTGG - Intergenic