ID: 963736092

View in Genome Browser
Species Human (GRCh38)
Location 3:149019392-149019414
Sequence GAGGTGAGCAGGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 599}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963736092_963736106 21 Left 963736092 3:149019392-149019414 CCCTCCACAGTCCTGCTCACCTC 0: 1
1: 0
2: 3
3: 53
4: 599
Right 963736106 3:149019436-149019458 CCCTGTCTTGCTGGCACCCAAGG 0: 1
1: 0
2: 0
3: 19
4: 232
963736092_963736108 22 Left 963736092 3:149019392-149019414 CCCTCCACAGTCCTGCTCACCTC 0: 1
1: 0
2: 3
3: 53
4: 599
Right 963736108 3:149019437-149019459 CCTGTCTTGCTGGCACCCAAGGG 0: 1
1: 0
2: 2
3: 18
4: 133
963736092_963736102 12 Left 963736092 3:149019392-149019414 CCCTCCACAGTCCTGCTCACCTC 0: 1
1: 0
2: 3
3: 53
4: 599
Right 963736102 3:149019427-149019449 CCACTCACCCCCTGTCTTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963736092 Original CRISPR GAGGTGAGCAGGACTGTGGA GGG (reversed) Intronic
901185001 1:7367344-7367366 GGAGTGAGCAGGGCTGGGGACGG - Intronic
901238602 1:7680360-7680382 GAGGGGAGGAGGGCTGGGGAAGG + Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
902709673 1:18230207-18230229 ATGGTGAGCAGGACTGGGGCAGG + Intronic
902882776 1:19383799-19383821 GAGGTGAGGAGGACTCGGGGAGG - Intronic
903837195 1:26212375-26212397 GAGCTAAGCAGGGCTGTGCAAGG + Intergenic
904351004 1:29906727-29906749 GAGATGAAGAGGCCTGTGGAAGG - Intergenic
904477762 1:30775822-30775844 GAGGGGAGCTGAACTGAGGAGGG + Intergenic
905473504 1:38209841-38209863 GAGGTGGCGGGGACTGTGGAAGG + Intergenic
905890429 1:41515431-41515453 GATGAGAGCAGGGCTGGGGATGG + Intronic
906679412 1:47715276-47715298 TAGGTGAGCAGGACTGAGCTGGG - Intergenic
908081824 1:60589088-60589110 GTGATGGGAAGGACTGTGGATGG - Intergenic
908211334 1:61903394-61903416 GAGATGGGCAAGACTGTGGGAGG + Intronic
909020773 1:70428240-70428262 GAGGTGGGGAGGACAGAGGATGG + Intronic
909402418 1:75248943-75248965 GAGCTGAGCAATACTTTGGATGG + Intronic
911136643 1:94447448-94447470 TAGCTGAGCAGGACTGTGAATGG + Intronic
912107904 1:106303857-106303879 GTGGTCAGCAAGCCTGTGGAGGG + Intergenic
912512144 1:110196990-110197012 GGGGTGAGCAGAATTCTGGAAGG - Intronic
913163112 1:116163206-116163228 GAGGTGAAAAAGACAGTGGAGGG + Intergenic
913729657 1:121697098-121697120 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913729814 1:121698964-121698986 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913729970 1:121700830-121700852 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913730128 1:121702696-121702718 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913730282 1:121704562-121704584 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913730438 1:121706428-121706450 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913730744 1:121710160-121710182 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913730895 1:121712026-121712048 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913731053 1:121713892-121713914 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913731204 1:121715758-121715780 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913731356 1:121717624-121717646 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913731505 1:121719489-121719511 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913731660 1:121721355-121721377 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913731810 1:121723220-121723242 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913731967 1:121725086-121725108 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913732120 1:121726952-121726974 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913732269 1:121728817-121728839 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913732426 1:121730682-121730704 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913745043 1:121893660-121893682 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913745198 1:121895526-121895548 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913745355 1:121897392-121897414 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913745574 1:121900085-121900107 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913745729 1:121901951-121901973 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913745763 1:121902562-121902584 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913745919 1:121904428-121904450 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913746227 1:121908158-121908180 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913746382 1:121910024-121910046 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913746558 1:121912236-121912258 GAGCTGAGCAGGCCTTTTGATGG - Intergenic
913749638 1:121948321-121948343 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913749789 1:121950186-121950208 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913749917 1:121951825-121951847 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913750412 1:121958547-121958569 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913750567 1:121960413-121960435 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913750723 1:121962279-121962301 GAGCTGAGCAGGTCTTTTGATGG - Intergenic
913751833 1:122026674-122026696 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913752302 1:122032270-122032292 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913754104 1:122053145-122053167 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913754578 1:122058827-122058849 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913755048 1:122064425-122064447 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913755866 1:122073755-122073777 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913757161 1:122088856-122088878 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913758817 1:122108064-122108086 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913760653 1:122129191-122129213 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913761303 1:122136652-122136674 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913762766 1:122153447-122153469 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913764208 1:122170243-122170265 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913764863 1:122177914-122177936 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913765016 1:122179781-122179803 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
913767395 1:122207441-122207463 GAGCTGAGCAGGTCTTTTGATGG + Intergenic
914767952 1:150655929-150655951 TAGCTGAGCAAGACTGTGAATGG + Intronic
915064464 1:153213195-153213217 GAGCTGAGGAAGACTGTGGTAGG + Intergenic
915072988 1:153287735-153287757 GAGGTGAGGAAGACTGTGGTAGG + Intergenic
915586223 1:156845352-156845374 AAGGTGAGCAGGACTAGGGCAGG - Exonic
916853476 1:168727003-168727025 TTGGTTACCAGGACTGTGGAGGG - Intronic
917300694 1:173570899-173570921 GTGGTGGGGAGGACTGGGGAGGG + Intronic
918070816 1:181132189-181132211 GAGGTGAACAGGTGGGTGGAGGG - Intergenic
918441126 1:184568045-184568067 GAGGTGTGCAGGAGTGTGCTGGG - Intronic
919162793 1:193853386-193853408 GAGGGGAGCAGGAAAGAGGATGG - Intergenic
919688417 1:200506494-200506516 GAGGTGAGGAGAGATGTGGAAGG + Intergenic
920126006 1:203694322-203694344 TAGGTGAGAAGACCTGTGGAGGG + Intronic
921226860 1:213029229-213029251 TAGCTGAGCAAGACTGTGAAAGG - Intergenic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
922505612 1:226123812-226123834 GAGCTGACCAGGAGTCTGGATGG + Intergenic
922563813 1:226588259-226588281 AAGCTGAGCAGGTCTGCGGAGGG - Intronic
922618774 1:226978307-226978329 GAGGTGTGCAGGTGTGTGGTGGG - Intronic
922618855 1:226978650-226978672 GAGGTGGGCAGGTGTGTGGAGGG - Intronic
922618863 1:226978681-226978703 GAGGTGTGCAGGTGTGTGGAGGG - Intronic
922618920 1:226978954-226978976 GAGGTGTGCGGGTGTGTGGAGGG - Intronic
923717647 1:236438456-236438478 GTGGTGACCAGGGCTGTGGTGGG + Intronic
924765389 1:247027285-247027307 TAGCTGAGCAAGACTGTGAATGG + Intergenic
924904173 1:248433938-248433960 GAGGTCAGCGGGACTGCGGTCGG - Intergenic
924923722 1:248658113-248658135 GAGGTCAGCGGGACTGCGGTCGG + Intergenic
1062812541 10:477467-477489 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1062812555 10:477501-477523 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1062906498 10:1183149-1183171 GAGCTGAGCGGGACGCTGGAGGG - Exonic
1063520355 10:6735617-6735639 GGGGAGATCAGGAGTGTGGAAGG - Intergenic
1063613217 10:7580674-7580696 GAAGACAGCAGGAATGTGGAGGG + Intronic
1064164611 10:12975361-12975383 GGGCTGAGCAGAACTCTGGAAGG - Intronic
1064925340 10:20563335-20563357 TAGGAGAGTAGGACAGTGGATGG - Intergenic
1066801845 10:39201530-39201552 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1066988540 10:42489965-42489987 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1066989452 10:42498432-42498454 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1067068131 10:43114976-43114998 CAGGGGAGCAGCAGTGTGGATGG + Intronic
1067133579 10:43588178-43588200 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1067154948 10:43773123-43773145 GTGGTGAGCAGGAGTGTGGGAGG - Intergenic
1068166464 10:53338467-53338489 TAGCTGAGCAAGACTGTGAATGG - Intergenic
1068180055 10:53505361-53505383 GAGATAAGCAAGACAGTGGAAGG - Intergenic
1069056598 10:63850651-63850673 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1069491497 10:68865290-68865312 TAGCTGAGCAGGACTGTGAACGG - Intronic
1069973083 10:72190044-72190066 GGGGTGGGGAGCACTGTGGAGGG - Intronic
1070401193 10:76055166-76055188 GAGGTTAGCAGGTATTTGGAGGG + Intronic
1070475711 10:76827214-76827236 GAGACCAGCTGGACTGTGGATGG + Intergenic
1070819332 10:79345899-79345921 GAGGTGAGCAGGCCTGAGTGGGG - Intergenic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1073067283 10:100770192-100770214 GAGGTGAGCATGCCTGTGGTGGG + Intronic
1074918949 10:117987785-117987807 CAGGAGAGCAGGGCTGGGGAGGG - Intergenic
1075080127 10:119378132-119378154 GAGGTCAGCAGGAGTGTGTGTGG - Intronic
1076163854 10:128266816-128266838 GGGGTGAGCTGGGGTGTGGATGG + Intergenic
1076802261 10:132836056-132836078 GAGGTGAGCAGGGCTGTGTCGGG - Intronic
1076915883 10:133423059-133423081 GGCGTGGGCAGGACGGTGGATGG + Exonic
1077350404 11:2090567-2090589 CAGATGAGCAGGCCTGTGGAGGG - Intergenic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077704195 11:4468385-4468407 GCGGTGAGCAGGAAGGTGGGTGG + Intergenic
1078100774 11:8329128-8329150 GAGGTGGGAAGGACTGTAGGAGG + Intergenic
1078364152 11:10692904-10692926 GAGGTGAGCAGGGCCGGGCACGG + Intronic
1080653819 11:34243002-34243024 GAGGTGGGCAGGGCTGTGGAGGG - Intronic
1080760609 11:35245482-35245504 GAGGGGAGCAGGACAGGGAAGGG - Intergenic
1080862988 11:36166380-36166402 AAGGTGACCTGGACTCTGGAGGG + Intronic
1082356815 11:51591048-51591070 GAGGTGAGCAATCCTGTTGATGG + Intergenic
1082374410 11:51846942-51846964 GAGGTGAACAATACTGTTGATGG + Intergenic
1082415923 11:52449071-52449093 GAGGTGAACAGTCCTGTTGATGG + Intergenic
1082436663 11:52749123-52749145 GAGGTGAACAATCCTGTGGATGG + Intergenic
1082446093 11:52885106-52885128 GAGGTGAGCAATCCTGTTGATGG + Intergenic
1082447315 11:52902957-52902979 GAGGTGAACAATACTGTTGATGG + Intergenic
1082452838 11:52982873-52982895 GAGGTGAACAATCCTGTGGATGG + Intergenic
1082533844 11:54154030-54154052 GAGGTGAACAGTCCTGTTGATGG + Intergenic
1082657151 11:55869560-55869582 GAGGTGCACAGGCCTGTGGGGGG - Intergenic
1084084318 11:66847909-66847931 GAACTGAGCAGGAGTCTGGAGGG + Intergenic
1085245357 11:75096804-75096826 TAGGTGAGCTGGGCTGGGGATGG - Intergenic
1085279599 11:75321247-75321269 GGGGTGAGCAGGAATGGGGTGGG - Intronic
1085747450 11:79127314-79127336 GAGTTGAACAGGAATGTGGTGGG - Intronic
1088310683 11:108457198-108457220 GAGATAAGCAGGGCTGTGGAGGG + Intronic
1088492223 11:110399432-110399454 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1088707536 11:112477376-112477398 GAGCTGAGCAGGACTCAGGCTGG - Intergenic
1089094305 11:115906128-115906150 AAGATGACCAGGAATGTGGAAGG + Intergenic
1090439800 11:126716046-126716068 GAGGTGAGGGGGAATGTGGGAGG + Intronic
1091351557 11:134901646-134901668 GAGGTGGACAGGAGTGTGGGAGG - Intergenic
1093659275 12:21735782-21735804 GAGGTGAGCTAGAATTTGGAGGG - Intronic
1094462937 12:30717400-30717422 GAGGTTAGCAGAGCTGTGGAGGG + Intronic
1096183067 12:49561315-49561337 GAAGTGAGGGGGAGTGTGGAGGG + Intronic
1096220559 12:49826137-49826159 GAGGTGGGCAGGGCTGGGGGTGG + Intronic
1096561486 12:52438943-52438965 GAGGAGAGAAGAACTGTCGAAGG + Intergenic
1097134219 12:56837922-56837944 GAGGTGAGCAGGGCAGGAGAGGG - Intergenic
1097635406 12:62115649-62115671 GTGGGAAGCAGGACTGTGGGAGG - Intronic
1097707513 12:62883154-62883176 GAAGTGAGCAGGATGGAGGAGGG - Intronic
1101223493 12:102664946-102664968 TAGCTGAGCAAGACTGTGAATGG - Intergenic
1101227960 12:102708759-102708781 GAGGTGAGGAGAACTATGGATGG + Intergenic
1101336571 12:103802060-103802082 GAGGTGAGCTGGACTCTGGAGGG - Intronic
1101501274 12:105306553-105306575 TAGCTGAGCAAGACTGTGAATGG - Intronic
1101740210 12:107494713-107494735 GAGGTGGCGAGGGCTGTGGAAGG - Intronic
1101743110 12:107516683-107516705 GACGAGAGCAGGAGTGTGAAAGG + Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102730639 12:115105929-115105951 AAGGTGAAGAGGGCTGTGGATGG - Intergenic
1103733572 12:123044220-123044242 GAGGTGACCAGGAGTGAGAAAGG - Intronic
1103862171 12:124024220-124024242 GAGGAGATCAGGAATGGGGAAGG - Intronic
1105394713 13:20019616-20019638 GAGGTAAGCAGGAATGTAAATGG + Exonic
1105469762 13:20682894-20682916 TAGCTGAGCAAGACTGTGAACGG - Intronic
1106830818 13:33580624-33580646 GAAATGAGCAGTATTGTGGAGGG + Intergenic
1108865493 13:54918111-54918133 TAGCTGAGCAAGACTGTGAAGGG - Intergenic
1110112247 13:71762508-71762530 GAGGCGAGCAGCACTTTGGGAGG + Intronic
1111590205 13:90336790-90336812 GAGGTGATCAGGACAGGTGAGGG + Intergenic
1112199446 13:97260829-97260851 GAGGTTAGCATATCTGTGGATGG - Intronic
1112780050 13:102890479-102890501 GAGTTTAGCAGCACTGTGTAGGG - Intergenic
1113179805 13:107612122-107612144 GAGGGGAGGAGGAGTGGGGAGGG + Intronic
1113816587 13:113175913-113175935 GAGCTCAGCAGGGCTGTGGGTGG - Intergenic
1114771467 14:25431834-25431856 GTGGTGGGCACGACTGTGGCGGG - Intergenic
1118025860 14:61768034-61768056 GAGGTGAGCAGCACTTTGGGAGG - Intronic
1119581249 14:75783468-75783490 GATGTGTGCAGCACTTTGGAAGG - Exonic
1122272357 14:100573907-100573929 GAGGTGAGCAGGACCGGCCAAGG + Intronic
1122636281 14:103131203-103131225 GAGGGGAGCTGGAAGGTGGAGGG + Intronic
1122695890 14:103551905-103551927 GGGGTGAGGAGGACTGAGGGAGG - Intergenic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1122946803 14:105014990-105015012 GAGGTCAGCACGACTGAGCAGGG + Intronic
1123118116 14:105903882-105903904 GAAATGAGCAGGACTCAGGACGG + Intergenic
1202843537 14_GL000009v2_random:146176-146198 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1202912934 14_GL000194v1_random:136412-136434 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1202879711 14_KI270722v1_random:46265-46287 TAGCTGAGCAAGACTGTGAAGGG + Intergenic
1123627922 15:22240010-22240032 GAGGTGAGGTGGAAGGTGGAGGG - Intergenic
1123723928 15:23083754-23083776 GAGGTGTGCGGAACTGAGGAGGG - Intergenic
1124486227 15:30119601-30119623 TAGGTTACCAGGACTGGGGAAGG - Intergenic
1124541301 15:30588586-30588608 TAGGTTACCAGGACTGGGGAAGG - Intergenic
1124757357 15:32419001-32419023 TAGGTTACCAGGACTGGGGAAGG + Intergenic
1125118425 15:36122933-36122955 GAGGTCTGCAGGAAAGTGGAAGG + Intergenic
1125349076 15:38748748-38748770 AAGGTGAGAAGGACTGAGTAAGG - Intergenic
1125550607 15:40541726-40541748 GGGGTGAGCAGGAGTGAGGGAGG - Intronic
1126417971 15:48438637-48438659 GAGGAGGGCAGGGCTGTGGGTGG + Intronic
1127756188 15:62094612-62094634 GAGGGGAGAGGGACTGTGTATGG + Intergenic
1128161302 15:65424353-65424375 GAGATGAGGAAGACTGTGGGAGG - Intergenic
1128360750 15:66959960-66959982 GAGGGAAGGAGGACTGTGCAGGG - Intergenic
1128446278 15:67764135-67764157 GAGGTCAGCTGTACTGTGGTTGG - Intronic
1129740850 15:77988861-77988883 CAGGTGAGCCGGGCTGTGGCGGG + Intronic
1129936097 15:79451437-79451459 TGGGTGAGCAGGACTGCGGGAGG + Intronic
1130948895 15:88570242-88570264 GAGGAGAGCAAGGCTGGGGAAGG + Intergenic
1131037989 15:89237804-89237826 TAGCTGAGCAAGACTGTGAATGG - Intergenic
1132846615 16:2003750-2003772 GTGGTGAGCAGGACTGGGATGGG + Intronic
1133570781 16:7038087-7038109 GAGGTGGGAAAGAGTGTGGAGGG - Intronic
1133634444 16:7652339-7652361 GAGGTGAGGAGGAGTTAGGAAGG - Intronic
1133953759 16:10421893-10421915 TAGCTGAGCAAGACTGTGAATGG - Intronic
1136173482 16:28502405-28502427 GAAGGGAACAGGGCTGTGGATGG - Intronic
1136638570 16:31542073-31542095 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1136719577 16:32309844-32309866 GAGGTGAGCAAGTCTGTCGGTGG - Intergenic
1136777245 16:32878566-32878588 GAGGAGTGCAGCACTGTGGGTGG + Intergenic
1136837951 16:33516124-33516146 GAGGTGAGCAAGTCTGTCGGTGG - Intergenic
1136849321 16:33601238-33601260 CAGGTGTGCAGGACTGCAGAGGG + Intergenic
1136893378 16:33982947-33982969 GAGGAGTGCAGCACTGTGGGTGG - Intergenic
1137259471 16:46812514-46812536 GAGGTAGACAGGATTGTGGATGG + Intronic
1137465754 16:48707425-48707447 GGGATGAACAGGACTGTGCAAGG - Intergenic
1137668598 16:50266410-50266432 GCGGAGAGCAGCACTGTGGCTGG + Intronic
1137779672 16:51087355-51087377 GGGATGAGCAGCACTGTGGCAGG + Intergenic
1137926375 16:52546202-52546224 GAGGTAAGAAGGACTGGGGGTGG + Intronic
1138439205 16:57024201-57024223 GGGGTGAGCAGGGATGGGGAGGG + Intronic
1139680981 16:68562768-68562790 TAAGTGAGCAGGACTGTGTTAGG - Intronic
1140725455 16:77807530-77807552 GAGGGAAGCTGGACTGGGGACGG - Intronic
1141678075 16:85528027-85528049 GAGGTGGGCAGGGGTGTGGGGGG + Intergenic
1141724041 16:85774542-85774564 GGGGTGAGCAAGAATGGGGAAGG + Intronic
1142352230 16:89585783-89585805 CAGGTGAGCAGGACGGGGTAGGG + Exonic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1203006854 16_KI270728v1_random:207925-207947 GAGGTGAGCAAGTCTGTCGGTGG + Intergenic
1203079659 16_KI270728v1_random:1140675-1140697 GAGGAGTGCAGCACTGTGGGTGG + Intergenic
1203111028 16_KI270728v1_random:1449888-1449910 CAGGTGTGCAGGACTGCAGAGGG + Intergenic
1203148129 16_KI270728v1_random:1816408-1816430 GAGGTGAGCAAGTCTGTCGGTGG - Intergenic
1143502990 17:7349820-7349842 GTGGTAATCAGGAGTGTGGAAGG - Intronic
1143712937 17:8746160-8746182 GAGGGGAGCAGGGCTGGGGTGGG - Intergenic
1143765776 17:9136865-9136887 GAGCTGGGCAGGAGTGAGGAAGG - Intronic
1144736988 17:17560817-17560839 GAGGTGGGGAGGAGTGTCGAGGG - Intronic
1145802567 17:27698033-27698055 TAGCTGAGCAGGACTGTGAATGG + Intergenic
1145939941 17:28737998-28738020 GAGGTGAGCAGGCCAGGGGGTGG + Exonic
1145960248 17:28883030-28883052 GAGGTGTGCAGGGCTGGGCAGGG - Intronic
1146294132 17:31635272-31635294 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1148639337 17:49174415-49174437 TAGCTGAGCAGGACTGTGAATGG - Intergenic
1148794185 17:50189323-50189345 GAGGTGTGCAGAGCTGGGGAGGG - Intronic
1149387607 17:56157285-56157307 CAGGTGAGGAGGAATGTAGAGGG + Intronic
1150481884 17:65517129-65517151 GTGGTCAGGAGGACAGTGGAAGG - Intergenic
1150833130 17:68541266-68541288 TTGGTGAGAGGGACTGTGGAGGG - Intronic
1151562277 17:74877068-74877090 GGGCTGGGCAGGGCTGTGGAAGG - Intergenic
1151682275 17:75628480-75628502 GAGGGGAGCAGGCCAGTGGAAGG - Intronic
1152092841 17:78256606-78256628 GAAGTGAGCAGGGGTGGGGATGG + Intergenic
1152405440 17:80095627-80095649 CAGGTTAGCAGAACTGGGGATGG - Intronic
1152722809 17:81931202-81931224 GAGGTGAGGAGGTGTGTGGGGGG - Intergenic
1152879323 17:82806434-82806456 GAGGAGAACAGGGCAGTGGATGG - Intronic
1153584340 18:6605781-6605803 GGGGTAAGCAGAACTGAGGATGG + Intergenic
1153999020 18:10467800-10467822 GTGGTGAGCAGCCCTGTAGAGGG + Intronic
1154234989 18:12596875-12596897 GGGGTTAGCAGGACAGTGCAGGG - Intronic
1154980098 18:21496745-21496767 GAGGTGTGTAGGAATTTGGAAGG + Intronic
1155115997 18:22767588-22767610 GAAGGCAGCAGGACTGAGGATGG - Intergenic
1156454459 18:37285189-37285211 GGGATGGGCAGGACTGGGGAGGG - Intronic
1157616462 18:48990464-48990486 GAGGGGCCCAGGACAGTGGAGGG - Intergenic
1157688756 18:49664099-49664121 GAGCTGAGCAGCACTGTGAGTGG - Intergenic
1157844854 18:50993770-50993792 GTGGTGTGCAGGGCTGGGGAGGG - Intronic
1158296568 18:56003089-56003111 GAGATGTGCATGATTGTGGAGGG + Intergenic
1159524379 18:69568653-69568675 GAGGTGAGCAGCAGTGGGCAAGG + Intronic
1160337453 18:78055000-78055022 GAGGAGAGCAGGAGTGGGGGTGG + Intergenic
1160358422 18:78248288-78248310 GAGGGGGGCAGCACTGGGGAGGG + Intergenic
1160376283 18:78415042-78415064 GGGGTCTGCAGGACTGTGGAGGG - Intergenic
1160477840 18:79208835-79208857 GAGGTGAGCAGGACAGTTTCTGG + Intronic
1160695571 19:482773-482795 TAGGTGGGCAGGACAGTGCAGGG - Intergenic
1160906467 19:1453802-1453824 GAGGTCAGCCGGGCTGGGGAGGG - Intronic
1161021614 19:2014000-2014022 GAGGTGGTGAGGACTGGGGACGG + Intronic
1162282994 19:9715299-9715321 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1162326793 19:10004214-10004236 GAGGTGGGCAGGACTGCTGGGGG - Intronic
1162336103 19:10061527-10061549 TAGGTGATCAGGACTGGGCATGG + Intergenic
1162432915 19:10639910-10639932 GAGGTTAACAAGGCTGTGGAGGG + Intronic
1162642716 19:12024333-12024355 TAGCTGAGCAAGACTGTGAACGG + Intronic
1162801371 19:13112605-13112627 AAGCTGAGCAGGTCTGAGGAGGG + Intronic
1162921580 19:13906334-13906356 GAGGAGTGCAGGACTCAGGAAGG + Exonic
1162934614 19:13975493-13975515 GAGTTGAGGGGGACAGTGGAAGG + Intronic
1163222493 19:15931497-15931519 GAGGTGAGAAAGACTTGGGATGG + Intronic
1164024795 19:21342050-21342072 TAGCTGAGCAAGACTGTGAATGG - Intergenic
1164256991 19:23536030-23536052 TAGCTGAGCAAGACTGTGAACGG + Intronic
1164306231 19:24006033-24006055 TAGCTGAGCAAGACTGTGAATGG - Intergenic
1164920866 19:32087677-32087699 GAGGTCAGCTGGACTGGGGGTGG - Intergenic
1165079832 19:33300905-33300927 GAGGGGAGCAGGCCCGTGGCAGG - Exonic
1166226581 19:41399420-41399442 GAGGTGGGCAGGACTGGGGCAGG + Intronic
1166658992 19:44633140-44633162 TAGCTGAGCAAGACTGTGAACGG - Intronic
1166727933 19:45039938-45039960 GAGGTGAGCATCACTGGGAAAGG - Intronic
1167622177 19:50566526-50566548 GAGGTGAGGAGGTCTGGGGAAGG + Intronic
1167672121 19:50859381-50859403 GAGGGCAGCAGGGATGTGGAGGG + Intronic
1202655329 1_KI270708v1_random:15285-15307 TAGCTGAGCAAGACTGTGAAGGG + Intergenic
925125316 2:1450612-1450634 CAGGTCAGCAGGACTGAGAAGGG - Intronic
925246368 2:2387156-2387178 GAGGTGTGGAGGGCTGTGGAAGG - Intergenic
926162920 2:10501165-10501187 AGGGTGAGCAGGAAAGTGGATGG - Intergenic
926217843 2:10916017-10916039 GAGGGGAGGAGGGTTGTGGAAGG + Intergenic
926300761 2:11600424-11600446 AAGGTCAGAAGGACTGTGTAAGG + Intronic
926446601 2:12950186-12950208 GAAGTAAGAAGGAATGTGGAGGG - Intergenic
927014041 2:18937667-18937689 GACATGAGCAGGAGTGGGGAGGG - Intergenic
927038383 2:19204010-19204032 GAGGGGAGCAGGGCTATGGGTGG - Intergenic
927222384 2:20725328-20725350 GAGATGAGCTCTACTGTGGATGG + Intronic
927884437 2:26709930-26709952 GAGGTGGGAGGGAATGTGGAAGG - Intronic
928375412 2:30769532-30769554 GTTGTGTGCAGGACTGTGGATGG - Intronic
929158637 2:38810535-38810557 CAGGTGAGCATGAACGTGGAGGG - Intronic
930851520 2:55966005-55966027 AAGGAGAGCAGGGCTGTGAAAGG + Intergenic
930918447 2:56722216-56722238 TAGCTGAGCAAGACTGTGAATGG + Intergenic
931575064 2:63710197-63710219 GCGATGAGCAGCACTGTGGCAGG + Intronic
933039033 2:77437866-77437888 GAGGTGAGGAGGAATGAGTAGGG + Intronic
933265798 2:80179318-80179340 GAGATGAACAGGAATGTGGTGGG + Intronic
933298452 2:80516690-80516712 TAGATGATCAGGACTGTGAATGG - Intronic
935025668 2:99274679-99274701 TAGATGAGCAAGACTGTGAACGG - Intronic
935618951 2:105112268-105112290 GAGGGAAGGAGGAATGTGGAGGG + Intergenic
935897799 2:107756443-107756465 CAGGTGAGAAGGACTGTGCGAGG - Intergenic
935915568 2:107946164-107946186 TAGCTGAGCAAGACTGTGGATGG - Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937580777 2:123485049-123485071 AAGATGAGGATGACTGTGGAAGG - Intergenic
937821168 2:126312776-126312798 GAGCTGAGTGGGTCTGTGGATGG - Intergenic
938029262 2:127978307-127978329 GAAGTGAGCAGGAATGGGGAAGG - Intronic
938309274 2:130276585-130276607 GAGGTTGGAAGGAGTGTGGAGGG - Intergenic
938446221 2:131381490-131381512 GAGGTTGGAAGGAGTGTGGAGGG + Intergenic
940002053 2:148976057-148976079 GAGCAGAGCAGTACTGTAGAGGG - Intronic
940187978 2:151007757-151007779 GAAGGGAGCAGGACTGGGCAGGG - Intronic
942331334 2:174827895-174827917 GAGGTGGGGAGGACTGTGGAAGG + Intronic
942983522 2:182110932-182110954 GAGGGGCACATGACTGTGGAGGG + Intronic
943307678 2:186285283-186285305 AAGGTGAACAAGAATGTGGAAGG - Intergenic
944027447 2:195188251-195188273 GAGGTGAATTGGACTGTGGTAGG - Intergenic
944984987 2:205166353-205166375 GAGGTGAGCAGGAATGCAAAGGG + Intronic
945725954 2:213472436-213472458 GAGTTGAACAGGAATGTGGTGGG + Intronic
946301575 2:218827506-218827528 GAGCTGAGTGGGACTGGGGAAGG + Intronic
948386593 2:237584632-237584654 CAGGTGAGCTGGACTGGGGATGG - Intronic
948456280 2:238106042-238106064 GAGGAAAGCAGGAGTGAGGATGG - Intronic
948861517 2:240754958-240754980 GAGGGGAGCAGGGCTGGGGAGGG - Intronic
948975437 2:241460856-241460878 GACGTGTGCAGGACTCTGGCGGG + Intronic
1168797365 20:620507-620529 GAGCTGAGCAGGGCTCTGGAGGG + Intergenic
1169403819 20:5306447-5306469 TAGCTGAGCAAGACTGTGAATGG + Intronic
1169753811 20:9022833-9022855 AGGGTGGACAGGACTGTGGATGG - Intergenic
1169900459 20:10547425-10547447 GAGGTGAAAAGGACTCAGGAGGG - Intronic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1170666913 20:18394491-18394513 GAGGTGAGGAGGAGTCAGGAAGG - Intronic
1170786136 20:19469217-19469239 GAGATGAGGAGGACTGGGAAGGG + Intronic
1171009871 20:21503395-21503417 GAGGTGAGCAGGAGGGTGCTGGG - Intergenic
1171229349 20:23470269-23470291 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1172997949 20:39084406-39084428 AAGGTGAGGAAGACCGTGGAGGG - Intergenic
1173878641 20:46393791-46393813 GAGGTGTGCAGAACTGAGGAGGG + Intronic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1174443725 20:50576470-50576492 GAGGTGAGCAGGTGTGAGGGAGG + Intronic
1174644937 20:52077487-52077509 GAGGTGAGGGGGACAGTGTATGG + Intronic
1174948239 20:55012704-55012726 GCTGTGAGTAGGCCTGTGGAGGG - Intergenic
1175131191 20:56790890-56790912 GAGGTGGGAAGGAATGTGGCAGG + Intergenic
1175828749 20:61950918-61950940 GAGGGGCCCAGGGCTGTGGAAGG - Intergenic
1176632293 21:9151087-9151109 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1176641017 21:9303729-9303751 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1177505695 21:22015122-22015144 GAGTTGAACAGGAATGTGGTAGG + Intergenic
1178135685 21:29624869-29624891 GACGTGAGCTGGAGAGTGGATGG - Intronic
1178503612 21:33145592-33145614 GAGGTTTGCAGGACTGGGGGCGG + Intergenic
1178689736 21:34741009-34741031 GAGGGGAGCAGGATTGGGAATGG - Intergenic
1179901202 21:44395710-44395732 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901227 21:44395788-44395810 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901252 21:44395866-44395888 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901288 21:44395982-44396004 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901309 21:44396050-44396072 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901321 21:44396089-44396111 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901367 21:44396233-44396255 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901378 21:44396263-44396285 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901399 21:44396331-44396353 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901417 21:44396381-44396403 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901488 21:44396623-44396645 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901570 21:44396859-44396881 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901577 21:44396879-44396901 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1180056514 21:45361800-45361822 CAGGTGACCAGGGCTGTAGAGGG - Intergenic
1180109942 21:45643086-45643108 GTGGTGGGCAGGGCCGTGGATGG - Intergenic
1180350038 22:11793114-11793136 TAGCTGAGCAAGACTGTGAAAGG + Intergenic
1180388169 22:12199143-12199165 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1180621817 22:17167530-17167552 AAGCTGGGCAGGACTGGGGATGG - Intergenic
1180671185 22:17554797-17554819 GAGGACAGAAGGATTGTGGATGG + Intronic
1181166532 22:20986811-20986833 GCTGAGAGCAGGAGTGTGGATGG + Intronic
1181662130 22:24359437-24359459 AAGGTGAGGAGGATTATGGAAGG - Intronic
1181669287 22:24418663-24418685 GAGGGGCACAGCACTGTGGACGG - Intronic
1181699383 22:24611243-24611265 GAGGTGAGCAGGGCAGGGCATGG + Exonic
1181948602 22:26538212-26538234 GAGGTGAGGAGAACAGGGGAAGG + Intronic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182550883 22:31100197-31100219 GAGGAGAGCAGGACAGAGAAAGG - Intronic
1182702271 22:32250158-32250180 GAGGTGAGCAGTGATGTGCATGG + Intronic
1182956278 22:34429682-34429704 GAGGTGAGCAGGACAGTGACTGG - Intergenic
1183112121 22:35658139-35658161 GAAGTGAGTAGGAGGGTGGAGGG - Intronic
1183193132 22:36334648-36334670 TAAGCGAGCAGGAGTGTGGACGG + Intronic
1183716450 22:39535990-39536012 GAGGTGAGCAGTTCTGGAGAGGG + Intergenic
1184296176 22:43526951-43526973 CAGGTGTGCAGGACTCAGGATGG - Intergenic
1184423256 22:44394131-44394153 GAGTTGAGCAGGACTAATGATGG + Intergenic
1185127337 22:49018441-49018463 CAGGGGAGGAGGTCTGTGGAAGG + Intergenic
1185309155 22:50144140-50144162 GAGGTCAGCAGCACTGTTGGAGG - Exonic
1185337253 22:50276215-50276237 GCTGTGAGCAGGGCTGTGGGTGG + Intronic
1185415434 22:50706722-50706744 GAGGGGAGCAGGAGTGTGTTGGG + Intergenic
949828337 3:8186180-8186202 AAGGAGAGCATGCCTGTGGAAGG - Intergenic
949943664 3:9173680-9173702 GAGGTGGGCAGGGGTGGGGAGGG - Intronic
950170352 3:10834894-10834916 GAGGTTGGGAGGTCTGTGGAAGG - Intronic
950888015 3:16377765-16377787 GGGGTGAGCAAGACACTGGATGG - Exonic
951270383 3:20617244-20617266 TAGCTGAGCAAGACTGTGAACGG - Intergenic
951303322 3:21025837-21025859 GAGTTGAGCAAGGCTATGGATGG - Intergenic
951344008 3:21523856-21523878 GAGGAGGGCAAGACTGGGGAAGG + Intronic
952845940 3:37688196-37688218 CAGGTGACCAGAACTGTGGCTGG + Intronic
952858319 3:37791713-37791735 CATGTGGGCAGGACTGTGGAGGG - Intronic
952938788 3:38423552-38423574 TAGCTGAGCAAGACTGTGAATGG + Intergenic
953154172 3:40353864-40353886 GAGATGGGGAAGACTGTGGATGG - Intergenic
953312550 3:41893121-41893143 TAGGTTACCAGGACTGGGGAAGG + Intronic
953565625 3:44029337-44029359 GAGGTGAGCCTGACTCTGGCTGG - Intergenic
954232759 3:49230397-49230419 TAGCTGAGCAAGACTGTGAATGG + Intronic
954390994 3:50267827-50267849 GAGCTGGGCAGGAGTGTGGGTGG + Intronic
954810581 3:53244795-53244817 GGGGTGAGGAGCACGGTGGAGGG + Intronic
955573287 3:60330914-60330936 GATGTGAACAAGACTGTGGTTGG - Intronic
956116060 3:65920128-65920150 GATGTGAACAGGACTGTTGTGGG - Intronic
959587552 3:108039302-108039324 GAGGAGAGCAGGGCTGTGGTGGG - Intergenic
960575006 3:119220654-119220676 GGGGTGAGCTGGAGTGGGGAGGG + Intronic
961445911 3:126981638-126981660 CAGCTTAGCAGGAGTGTGGAAGG - Intergenic
962287056 3:134095164-134095186 GAGGTGAGTAGGCCAGTGGGTGG - Intronic
962443518 3:135444867-135444889 GAAGTGAGCAGTGCTGTGCATGG - Intergenic
962475568 3:135752224-135752246 GAGGGGAGGAGGACTGTGGGCGG - Intergenic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
963831725 3:150016033-150016055 GAGCTGAGCAGAAGTGGGGAGGG + Intronic
963995496 3:151703527-151703549 TAGCTGAGCAAGACTGTGAATGG + Intergenic
964747056 3:160022332-160022354 GTGCTGGGCAGGACTGTGCATGG - Intronic
965533575 3:169801403-169801425 GAGGTGAGGAGGACTTGGGCTGG - Intronic
965546530 3:169922061-169922083 GAGTTGAGGAAGACTGTGGAAGG + Intronic
966009149 3:175054312-175054334 TAGATGAGCAAGACTGTGAATGG - Intronic
966919591 3:184602969-184602991 GAGTTGGGCAGGCCTGTGGCTGG + Intronic
967265786 3:187691154-187691176 GAGGTGGGCAGGAGGATGGAGGG - Intergenic
1202745876 3_GL000221v1_random:101297-101319 TAGCTGAGCAAGACTGTGAACGG - Intergenic
968480701 4:831881-831903 GAGGTGAGCACAACTGTTGAGGG + Intergenic
968522550 4:1040621-1040643 GGGGTGACCAGGACTGCAGAGGG + Intergenic
968524582 4:1049487-1049509 GAGGTGAGCAAGGCTGAGGGAGG - Intergenic
968596165 4:1486813-1486835 GAGGAGAGCAGGGCTGTGGGAGG - Intergenic
968844269 4:3031239-3031261 GACGTGAGCAGGGCTGTGAACGG + Intronic
968909858 4:3472171-3472193 GAGGTGGGCACGGCTGGGGAGGG + Intronic
969306609 4:6329510-6329532 GAGATGAGCAGGGCTGTGTCGGG - Intronic
969565027 4:7972246-7972268 GAGGCGTGCAAGGCTGTGGAGGG - Intronic
969728280 4:8938785-8938807 GAGGGGAGCAGGTATGTGGGGGG + Intergenic
969764244 4:9215808-9215830 GACGTGGCCAGGATTGTGGAGGG - Exonic
969764850 4:9220555-9220577 GACGTGGCCAGGATTGTGGAGGG - Exonic
969765457 4:9225299-9225321 GACGTGGCCAGGATTGTGGAGGG - Exonic
969766070 4:9230044-9230066 GACGTGGCCAGGATTGTGGAGGG - Intergenic
969766683 4:9234788-9234810 GACGTGGCCAGGATTGTGGAGGG - Exonic
969767294 4:9239533-9239555 GACGTGGCCAGGATTGTGGAGGG - Intronic
969767899 4:9244282-9244304 GACGTGGCCAGGATTGTGGAGGG - Exonic
969768501 4:9249033-9249055 GACGTGGCCAGGATTGTGGAGGG - Exonic
969769108 4:9253781-9253803 GACGTGGCCAGGATTGTGGAGGG - Exonic
969769722 4:9258527-9258549 GACGTGGCCAGGATTGTGGAGGG - Exonic
969770327 4:9263275-9263297 GACGTGGCCAGGATTGTGGAGGG - Exonic
969770944 4:9268022-9268044 GACGTGGCCAGGATTGTGGAGGG - Exonic
969771554 4:9272767-9272789 GACGTGGCCAGGATTGTGGAGGG - Exonic
969771922 4:9325568-9325590 GACGTGGCCAGGATTGTGGAGGG - Exonic
969772538 4:9330314-9330336 GACGTGGCCAGGATTGTGGAGGG - Exonic
969773155 4:9335061-9335083 GACGTGGCCAGGATTGTGGAGGG - Exonic
969773770 4:9339806-9339828 GACGTGGCCAGGATTGTGGAGGG - Exonic
969774385 4:9344551-9344573 GACGTGGCCAGGATTGTGGAGGG - Exonic
969775000 4:9349296-9349318 GACGTGGCCAGGATTGTGGAGGG - Exonic
969775615 4:9354041-9354063 GACGTGGCCAGGATTGTGGAGGG - Exonic
969776230 4:9358786-9358808 GACGTGGCCAGGATTGTGGAGGG - Intronic
969776844 4:9363532-9363554 GACGTGGCCAGGATTGTGGAGGG - Exonic
969777459 4:9368277-9368299 GACGTGGCCAGGATTGTGGAGGG - Intergenic
971355519 4:25891356-25891378 GAGGTGAGGATGAAGGTGGAAGG - Intronic
972080481 4:35142952-35142974 TAGCTGAGCAAGACTGTGAACGG + Intergenic
972430887 4:38980781-38980803 GAGGGGAGCAGGTTTGTAGAGGG + Intronic
973008723 4:45045271-45045293 TAGCTGAGCAAGACTGTGAAAGG + Intergenic
973052141 4:45609800-45609822 GAAGGGAGCAGAAGTGTGGAGGG - Intergenic
973959540 4:56096048-56096070 GAGGTGAGGAGGATTGTAGAAGG + Intergenic
975352987 4:73366477-73366499 TAGCTGAGCAAGACTGTGAATGG + Intergenic
976041834 4:80895760-80895782 CAGCTGTGCAGAACTGTGGAAGG + Intronic
976544352 4:86317366-86317388 GAGGTGGGCAGGACTAAGGAGGG - Intronic
976557221 4:86463277-86463299 TAGCTGAGCAAGACTGTGAATGG + Intronic
976977651 4:91184335-91184357 TAGCTGAGCAAGACTGTGAATGG - Intronic
977563565 4:98558703-98558725 CAGGTGATCATGAATGTGGAAGG - Intronic
978833360 4:113116494-113116516 GGGGTGAGCAGGTCTGGGAAGGG - Intronic
979982590 4:127275182-127275204 TAGCTGAGCAAGACTGTGAATGG - Intergenic
980297648 4:130942975-130942997 TAGCTGAGCAGGACTGTGAATGG + Intergenic
980667516 4:135958766-135958788 TAGCTGAGCAGGACTGTGAACGG - Intergenic
981584439 4:146285973-146285995 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584445 4:146286021-146286043 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584457 4:146286113-146286135 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584485 4:146286305-146286327 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584488 4:146286329-146286351 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584494 4:146286377-146286399 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584497 4:146286401-146286423 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584509 4:146286493-146286515 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584512 4:146286517-146286539 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584538 4:146286685-146286707 GTGGTGAGGAGGACTGTGTCTGG + Intronic
981584544 4:146286733-146286755 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584547 4:146286757-146286779 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584558 4:146286849-146286871 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584571 4:146286969-146286991 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584574 4:146286993-146287015 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584597 4:146287161-146287183 GTGGTGAGAAGGACTGTGTCTGG + Intronic
981587503 4:146320300-146320322 GAGATGAGCAAGATTGTTGATGG + Intronic
982337795 4:154259127-154259149 AAGGTGAACAGGCATGTGGACGG - Intronic
983769837 4:171535598-171535620 GAGGTGGGCAGCACTTTGGGAGG + Intergenic
984169931 4:176346960-176346982 TAGCTGAGCAGGACTATGAATGG + Intergenic
985501010 5:245357-245379 TAGCTGAGCAAGACTGTGAACGG + Intronic
985519920 5:369355-369377 GAGGGGACCAGGACTGTGCCCGG - Intronic
985545166 5:505565-505587 GAGGTGAGAGTGACTGTGGGGGG + Intronic
985627670 5:998260-998282 GAGAAGAGCAGGACGGTGGGAGG + Intergenic
985733404 5:1564053-1564075 GAGGTGAGGAGGACAGGGGGAGG - Intergenic
985735851 5:1582169-1582191 TAGCTGAGCAAGACTGTGAACGG - Intergenic
986279992 5:6314954-6314976 GGGGTGAGCAGGAGCGTGGATGG + Intergenic
986298464 5:6459133-6459155 GAAGTCAGCAGGGCTCTGGAGGG - Intronic
987574225 5:19704965-19704987 TAGCTGAGCAGGACTGTGAACGG + Intronic
987878470 5:23711214-23711236 GGGGTGAGCAGGACGGGAGAGGG - Intergenic
989099057 5:37808010-37808032 GATCTGAGAAGGCCTGTGGAGGG - Intergenic
989239978 5:39192943-39192965 GAGGTGAACAGAACACTGGATGG - Intronic
989552983 5:42757284-42757306 GAGGTGAGGAGGAAAGAGGAGGG + Intronic
989742706 5:44791266-44791288 TAGCTGAGCAAGACTGTGAATGG + Intergenic
989758916 5:44988789-44988811 TAGCTGAGCAAGACTGTGAATGG + Intergenic
990185371 5:53204774-53204796 GAGGTGGGCAGCAATCTGGAGGG - Intergenic
990190078 5:53249652-53249674 GTGGCCAGCAGGACTGTGCAAGG - Intergenic
990350564 5:54911556-54911578 CAGGTGAGAGGGTCTGTGGAGGG - Intergenic
990762023 5:59140052-59140074 GAGAGGAGTAGGATTGTGGAAGG + Intronic
990780323 5:59353701-59353723 GAGGGGAGCAGGGCCGTGGAAGG - Intronic
991007141 5:61840631-61840653 GAGGATTGCAGGAATGTGGAAGG - Intergenic
991540300 5:67720449-67720471 GAGGAGAGCAGGAGAGGGGAGGG - Intergenic
991946025 5:71899196-71899218 GAGTTGAACAGGAATGTGGTGGG - Intergenic
993406127 5:87513556-87513578 TAGCTGAGCAAGACTGTGAACGG + Intergenic
995062930 5:107831107-107831129 GGGGAGAGGAGGAGTGTGGAAGG - Intergenic
995183363 5:109249021-109249043 GAGGGAAGCAGGACAGTGCAGGG + Intergenic
995400607 5:111736909-111736931 GAGGGCAGCAGGATAGTGGAAGG - Intronic
996280903 5:121728118-121728140 GAAGTGAGCAGGACAGGAGAGGG + Intergenic
996532645 5:124542481-124542503 GAGGTGGGCTGGTGTGTGGAGGG - Intergenic
998924526 5:147107199-147107221 GAGATGAGCAGTACAGTGAAGGG - Intergenic
1000142486 5:158419029-158419051 GGAGTGAGCTGGACTTTGGATGG + Intergenic
1000616949 5:163437748-163437770 GAGGTGAGCAGGCCCGGGGAGGG + Exonic
1001732040 5:173967878-173967900 GGTGTGATCAGGAGTGTGGAAGG - Intergenic
1001893382 5:175358293-175358315 GAGGTGAGCAGGTCAGAGCATGG - Intergenic
1002443474 5:179276024-179276046 GAGGTCAGCAGGGCTGTGGGAGG + Intronic
1003322471 6:5063816-5063838 GAGATGAACAGGACTGTCCAGGG - Intergenic
1003433721 6:6066343-6066365 TAGCTGAGCAAGACTATGGATGG - Intergenic
1003892032 6:10572148-10572170 AAGGTGAGCAGGAATGGGGTGGG - Intronic
1004629789 6:17410220-17410242 GAGGTGTGCAGGGATGTGGTGGG - Intronic
1004866300 6:19856581-19856603 GAGGGGGGCAGGAGTGGGGAAGG + Intergenic
1004944906 6:20601609-20601631 GAGATGAGCAAGAATCTGGAAGG + Intronic
1005209775 6:23447308-23447330 CAGGGGAGGAGGACTATGGAGGG - Intergenic
1005814428 6:29539190-29539212 GAGGTGAGCAGGAGAGAGGTTGG - Intergenic
1005858085 6:29879286-29879308 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1005969318 6:30749043-30749065 GAGGGTAGCAGGAATGGGGATGG - Intergenic
1006007359 6:31013102-31013124 GGGGTGAGGAGGAGAGTGGAGGG - Intronic
1006316193 6:33293229-33293251 GGGGTCAGCTGGACTGTGCAGGG + Exonic
1006443762 6:34067636-34067658 GAACTGAGCAGGGCAGTGGAAGG - Intronic
1006460494 6:34155007-34155029 GAGGTGCCCAGCACTGTGGGAGG - Intronic
1007292782 6:40799775-40799797 GAGGTGGGCAGGACAGTGAAAGG + Intergenic
1007359736 6:41346367-41346389 CAGGTTAGCAGGACTGAGGTAGG - Intronic
1007472251 6:42098623-42098645 GAGCAGAGCAGGGCTGGGGAAGG + Intergenic
1008766900 6:54928287-54928309 GATGTGAACACGACTGTGTAAGG + Intronic
1009930982 6:70177399-70177421 GAGATGAGCAGGGCTTTGGGTGG - Intronic
1010350173 6:74864192-74864214 GAGGTTAGAAGGTCTGTAGAAGG - Intergenic
1012008611 6:93750732-93750754 GAGAAGAGCAGGAATGTGGCAGG - Intergenic
1013249574 6:108320884-108320906 GAGGAGAACAGGATTGTGGGAGG + Intronic
1013475412 6:110502397-110502419 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1013519466 6:110919287-110919309 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1014714726 6:124850250-124850272 GAGATGAGGAAAACTGTGGAAGG - Intergenic
1015374206 6:132491617-132491639 GAGGCCAGCAGGATGGTGGAAGG - Intronic
1016949327 6:149565350-149565372 GCGGTCAGCAGGCCTGTGGGAGG + Intergenic
1016993014 6:149942558-149942580 GAGCAGAGCAGGCCTGTGGCTGG - Intronic
1017791604 6:157804826-157804848 GATGTGAGCTGGAGCGTGGAGGG + Intronic
1017977229 6:159368995-159369017 GAGTTGAACAGGAATGTGGTGGG + Intergenic
1018135133 6:160771706-160771728 CAGGTGAGGAGCACTGTGGGAGG - Intergenic
1018666309 6:166141469-166141491 GAGGTGAGCTGTCCTGTGCAAGG - Intergenic
1018906413 6:168078760-168078782 GGGGTGAGCAGGGCCCTGGATGG - Intronic
1019595310 7:1855683-1855705 GAAGGGAGGAGCACTGTGGAGGG - Intronic
1020027922 7:4912196-4912218 GAGGTGTTCAGGAGGGTGGAGGG + Intronic
1021174231 7:17432088-17432110 GAAGTGAGCAGGGCTATGGTGGG + Intergenic
1022055931 7:26734454-26734476 GAGTTGTGAAAGACTGTGGATGG - Intronic
1022503409 7:30896436-30896458 AAGGTGAGCAGGAGAATGGAAGG - Intergenic
1023625515 7:42111594-42111616 CAGGAGAGCAGGCCTGAGGAAGG + Intronic
1023754072 7:43399565-43399587 GAGCAGGGCAGGACTGGGGAGGG + Intronic
1024300473 7:47883703-47883725 CAGCTGAGGAGGACTGTTGAAGG + Intronic
1024598490 7:50960064-50960086 GATCAGAGGAGGACTGTGGAGGG - Intergenic
1025102571 7:56148078-56148100 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1028210166 7:88064090-88064112 GATGTGAGCAGGAGGATGGAAGG + Intronic
1028605967 7:92656126-92656148 GAGGAGAACAGGAGCGTGGAGGG + Intronic
1028780049 7:94726069-94726091 TAGCTGAGCAAGACTGTGAATGG - Intergenic
1030498143 7:110325828-110325850 GCGGAGAGGAGGACTGTGGGTGG + Intergenic
1031475517 7:122216428-122216450 TAGGAGAGTAGGAGTGTGGATGG + Intergenic
1031811715 7:126377729-126377751 GAAGAGAGCAGCACTGTGGTTGG - Intergenic
1033549240 7:142431522-142431544 GAAATGAGCAGGCCTGTGCAAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034496824 7:151428032-151428054 GAGGTGCTCAGGACTGTTGGGGG - Intergenic
1034562114 7:151887095-151887117 AAGGTGAGACGGACTCTGGAGGG + Intergenic
1034574778 7:151987600-151987622 GAGGAGAGCAAGACTGGGGGTGG + Intronic
1034580950 7:152042185-152042207 TAGCTGAGCAGGACTGTGAATGG - Intronic
1034897956 7:154889777-154889799 GAGGGGAGCAGGGCTGGGGTGGG - Intronic
1034942601 7:155240954-155240976 TAGCTGAGCAAGACTGTGAAGGG - Intergenic
1035249175 7:157585748-157585770 GAGGGGAGGAGGAGTGGGGATGG + Intronic
1035546022 8:483070-483092 CAGGTGAGCAGGACTCTTGGCGG + Intergenic
1035783549 8:2246920-2246942 GAGGTGAGCAGGAGTGAGCCAGG - Intergenic
1035808575 8:2472666-2472688 GAGGTGAGCAGGAGTGAGCCAGG + Intergenic
1036062717 8:5342279-5342301 GAGGAGAGAAGGACTGGAGAGGG - Intergenic
1036273783 8:7332790-7332812 GACATGGCCAGGACTGTGGAGGG - Intergenic
1036274364 8:7337518-7337540 GACATGGCCAGGACTGTGGAGGG - Intergenic
1036346986 8:7972828-7972850 GACATGGCCAGGACTGTGGAGGG + Intergenic
1036347563 8:7977560-7977582 GACATGGCCAGGACTGTGGAGGG + Intergenic
1036842315 8:12133584-12133606 GACATGGCCAGGACTGTGGAGGG + Intergenic
1036842870 8:12138335-12138357 GACATGACCAGGACTGTGGAGGG + Exonic
1036863588 8:12375121-12375143 GACATGGCCAGGACTGTGGAGGG + Intergenic
1037458035 8:19083172-19083194 GAGGTGAGGAAGGGTGTGGAGGG - Intronic
1037779005 8:21855048-21855070 GGGGTGAGCAGGGCTGTGTCAGG - Intergenic
1038415634 8:27393187-27393209 GAGGTGGGCAGGAGTGAAGATGG - Intronic
1038497769 8:28016560-28016582 GAGGTGGGCAGGATTGTGCCAGG - Intergenic
1038779203 8:30556472-30556494 GAGGAGAGCTGCACAGTGGATGG - Intronic
1039615613 8:38952578-38952600 GAGGTGCCCAGCATTGTGGAGGG - Intronic
1039691981 8:39873747-39873769 TAGCTGAGCAAGACTGTGAAAGG + Intergenic
1039967906 8:42297100-42297122 GATGTGAACAGGTCTGAGGAAGG - Intronic
1040381688 8:46879071-46879093 TAGCTGAGCAAGACTGTGGACGG + Intergenic
1040469344 8:47724394-47724416 GAGGTGGGCAGACCTGTGGCTGG - Intronic
1040553331 8:48456486-48456508 GAGGTGAGCACCACTGTGTCTGG - Intergenic
1040609182 8:48965502-48965524 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1041006557 8:53502147-53502169 GAGGTGAGCAGGACGGCGTGGGG + Intergenic
1041065030 8:54074306-54074328 TAGCTGAGCAAGACTGTGAACGG + Intronic
1041762176 8:61378924-61378946 GTGGTCAGCAGTACTGTGCAAGG + Intronic
1042446602 8:68891855-68891877 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1044050583 8:87497937-87497959 GAGAAGACTAGGACTGTGGATGG + Intronic
1045251524 8:100487045-100487067 AAGGGGAACAGGAGTGTGGAAGG - Intergenic
1047563092 8:126010266-126010288 TAGCTGAGCAAGACTGTGAACGG + Intergenic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1049309835 8:141927995-141928017 GGGCTGAGCTGGACTGAGGACGG - Intergenic
1049673484 8:143879711-143879733 CCGGTGAGCAGGGCTGGGGATGG - Intergenic
1051699043 9:19800180-19800202 CAGGTGGGCATGAATGTGGAAGG + Intergenic
1052376846 9:27727307-27727329 GAGGTGAGCATTACTCTGAAAGG + Intergenic
1052520745 9:29545928-29545950 GAGATGGAGAGGACTGTGGATGG - Intergenic
1052839949 9:33284318-33284340 GAGTTTAGCAGGAATGGGGAAGG + Intergenic
1053054718 9:34987797-34987819 GGGGTGAGGAGGAGTGAGGAAGG - Intergenic
1053102257 9:35380888-35380910 TAGGAGAACAGGAGTGTGGAGGG - Intronic
1053357264 9:37456513-37456535 AAGATGAGCATGACTGAGGAAGG + Intronic
1055452286 9:76441711-76441733 AATGGGAGCAGGACTGTGGAAGG - Exonic
1057373054 9:94491353-94491375 GAGGTGAGCAGATCTCTTGAGGG + Intergenic
1058217366 9:102251867-102251889 GAGATGATCAGGTTTGTGGATGG + Intergenic
1059387656 9:113977235-113977257 GACGTGGGCAGGAAGGTGGAGGG + Intronic
1060036674 9:120261745-120261767 GAGGTGAGAAGGACTTTGCCCGG - Intergenic
1060256549 9:122035880-122035902 CAGGTGAGCAGGGCAGGGGAGGG - Intronic
1060405815 9:123372628-123372650 GGGGTGAGCAGGAATGGGGTGGG + Intronic
1060748891 9:126155959-126155981 GAGGTGAGGAGCACTGGGGCCGG - Intergenic
1061149469 9:128820701-128820723 GGGCTTAGCAGGACTGTGGCTGG - Exonic
1061647137 9:132013031-132013053 GGGGTGAGCAGGACAGGCGAAGG + Intronic
1061817062 9:133203840-133203862 GAGGTGGCCAGGACATTGGATGG + Intergenic
1203755121 Un_GL000218v1:118713-118735 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1203341867 Un_KI270423v1:257-279 GAGGTGAGCAATCCTGTTGATGG + Intergenic
1203714498 Un_KI270742v1:131253-131275 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1185517853 X:714487-714509 GATGTGTGCAGGACTTGGGACGG - Intergenic
1188283204 X:28296300-28296322 AAGCTGAACAGGACTCTGGAAGG + Intergenic
1191149545 X:57206666-57206688 TAGCTGAGCAAGACTGTGAATGG - Intergenic
1191580562 X:62756503-62756525 TAGCTGAGCAAGACTGTGAAAGG - Intergenic
1192916390 X:75655853-75655875 GTGGTGAGCAGACCTGTGTAGGG - Intergenic
1196790251 X:119458141-119458163 GATGTGAGGAAGACTGAGGAGGG + Intergenic
1196972091 X:121120739-121120761 GATGTAAGCAGTTCTGTGGATGG - Intergenic
1197754587 X:129984549-129984571 GAGGTGAACTGGTCGGTGGAGGG + Intronic
1198415680 X:136417428-136417450 GGGGTGAGCAGAACAGTAGAGGG + Intergenic
1199950817 X:152704521-152704543 GAGGTGTTCAGGCTTGTGGAGGG + Intergenic
1199958865 X:152763940-152763962 GAGGTGTTCAGGCTTGTGGAGGG - Intergenic
1200102615 X:153695482-153695504 GAGGAGTGCAGCACTGTGGGTGG - Exonic
1200970539 Y:9148084-9148106 TAGGTGAGCACGACTGTGAATGG - Intergenic
1200978811 Y:9242162-9242184 TAGCTGAGCAAGACTGTGAATGG + Intergenic
1201168742 Y:11236323-11236345 TAGCTGAGCAAGACTGTGAAAGG - Intergenic
1201189028 Y:11430518-11430540 GAGGTGAGCAAGACTGTCGGTGG + Intergenic
1202132560 Y:21626992-21627014 TAGCTGAGCAAGACTGTGAACGG - Intergenic
1202140477 Y:21716229-21716251 TAGCTGAGCATGACTGTGAATGG + Intergenic
1202146388 Y:21787568-21787590 TAGCTGAGCATGACTGTGAATGG - Intergenic