ID: 963737991

View in Genome Browser
Species Human (GRCh38)
Location 3:149042850-149042872
Sequence TTGGGTTATTTCCTGCTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963737985_963737991 17 Left 963737985 3:149042810-149042832 CCTAAAGTAACTCAACATGTAAC 0: 1
1: 0
2: 2
3: 24
4: 306
Right 963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG 0: 1
1: 0
2: 1
3: 15
4: 221
963737989_963737991 -6 Left 963737989 3:149042833-149042855 CCTGAGTCTTAAGTAAATTGGGT 0: 1
1: 0
2: 0
3: 10
4: 110
Right 963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG 0: 1
1: 0
2: 1
3: 15
4: 221
963737987_963737991 -5 Left 963737987 3:149042832-149042854 CCCTGAGTCTTAAGTAAATTGGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG 0: 1
1: 0
2: 1
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963737991 Original CRISPR TTGGGTTATTTCCTGCTGGT CGG Intronic
900504039 1:3020384-3020406 TCGGATTAATGCCTGCTGGTGGG + Intergenic
902148566 1:14423930-14423952 TTGGCTTATTTCCCTCTGTTGGG - Intergenic
902399754 1:16151435-16151457 TTGGTGTGTTTCCTGCTGGGGGG - Intronic
904070230 1:27790177-27790199 TGGAGTTAGTTCCTTCTGGTGGG + Intronic
909747258 1:79113107-79113129 TGGAGTTGGTTCCTGCTGGTGGG - Intergenic
910572877 1:88725143-88725165 TTGGGTTATTTCCAGCTTTTGGG + Intronic
911516249 1:98871677-98871699 TTGGGTTTTTTGTTGCTGATTGG + Intergenic
911807799 1:102234072-102234094 TTCAGTTTTTTCCTTCTGGTGGG + Intergenic
913655868 1:120959052-120959074 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
920840794 1:209551982-209552004 TTGTGTTATTTCTTGCTTATAGG - Intergenic
921019646 1:211224315-211224337 TTTGCTTATTTCCTTCTGGGTGG - Intergenic
1063321757 10:5058107-5058129 TTTGCTTATTTCCTTCTGGGCGG + Intronic
1063388157 10:5629969-5629991 TAGGGCTATGTTCTGCTGGTTGG - Intergenic
1064065921 10:12181517-12181539 TTGGCTTATTTCCTGCTCTGTGG - Intronic
1064603618 10:17016717-17016739 TTTGCTTATTTCCTTCTGGGTGG + Intronic
1065496418 10:26333179-26333201 TTGGGTCCATTCCTGCTGGGAGG + Intergenic
1065789465 10:29247075-29247097 TTGGGTTATTTCCAGTTTGGGGG + Intergenic
1066434735 10:35386984-35387006 TTCAGTGATTTCCTGCTGTTGGG + Intronic
1066689780 10:38014672-38014694 TTGGGCTATGTTCTGTTGGTTGG + Intronic
1068957892 10:62836657-62836679 TTGGGTTGTTTCCTGTTTTTTGG - Intronic
1069194583 10:65534159-65534181 TTTGGTCATTTCCTTTTGGTGGG - Intergenic
1071177864 10:82947369-82947391 TTGGGTTATTTCCAGTTTGGGGG + Intronic
1071378894 10:85037903-85037925 TTTGGCTACTTCCTGCTGGATGG - Intergenic
1071611187 10:87032683-87032705 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1071682645 10:87721947-87721969 TTGGGAAATTTCCTGTTGTTTGG - Intronic
1072021977 10:91410825-91410847 TTGGGTTATTTTCTGGGGCTTGG + Intronic
1075351433 10:121728363-121728385 TTGGGTTATTTCCAGAATGTTGG - Intergenic
1075798081 10:125135197-125135219 TTGGCTTCCTTCCTGGTGGTTGG - Intronic
1076487660 10:130835230-130835252 GTGGGTTACTCCCTGCGGGTGGG - Intergenic
1076487814 10:130835732-130835754 GTGGGTTACTCCCTGCGGGTGGG - Intergenic
1077419294 11:2442612-2442634 TTGGGTTATTTCCTAGAAGTGGG + Intergenic
1077634946 11:3836009-3836031 TTGGGTTCTTCCCTGCTGATGGG - Intronic
1077805916 11:5590869-5590891 TGGAGTTTTTTCCTTCTGGTGGG - Exonic
1080442136 11:32304528-32304550 TTGGGTTTTTTTCTGGTGGGGGG + Intergenic
1080641636 11:34161847-34161869 TTGGGTTATTGACTGCAGGTGGG + Intronic
1080647927 11:34200380-34200402 TTGGGTTATCTGCTTCTGTTTGG - Intronic
1081225248 11:40513432-40513454 TTGTGTGATTTCCTCCTGCTGGG - Intronic
1085540372 11:77262294-77262316 TTGGCTGATTTCCTGCTGACAGG - Intronic
1089326523 11:117661216-117661238 TTGAGTTTCTTCCTGCTGTTTGG - Intronic
1092221557 12:6717147-6717169 TGGAGTTTTTTCCTTCTGGTGGG - Intergenic
1093616237 12:21228882-21228904 GTTGGTCATTTCCAGCTGGTTGG - Intronic
1094254900 12:28412497-28412519 TGGAGTTGGTTCCTGCTGGTGGG + Intronic
1094507252 12:31072518-31072540 TGGAGTTTTTTCCTTCTGGTGGG - Intergenic
1098039525 12:66340031-66340053 TTGGGTTATTTCCTAATTTTTGG + Exonic
1098385379 12:69913149-69913171 TTGGGTTGTTTACTGTTGTTAGG + Intronic
1098482287 12:70977871-70977893 TAATGTTAATTCCTGCTGGTAGG - Intergenic
1099299827 12:80878437-80878459 TGGAGTTTGTTCCTGCTGGTGGG + Intronic
1100210548 12:92394173-92394195 TGGAGTTGGTTCCTGCTGGTGGG - Intergenic
1100392757 12:94158405-94158427 TTGGATTTTATCCTGATGGTTGG + Intronic
1100530271 12:95455885-95455907 TTTGGTTGTTTCCTTCTGGGTGG + Intergenic
1100885941 12:99070216-99070238 TTGGGTTCTAGCCTGATGGTTGG - Intronic
1101024419 12:100586704-100586726 CTTGGTTATTTCCTTCTGCTGGG - Intronic
1101704842 12:107211966-107211988 TTTGTTTATTTCCTTCTGGGTGG - Intergenic
1101915406 12:108892108-108892130 TTGGCTTATTTCCTGTTCTTTGG + Intronic
1102345241 12:112155834-112155856 TTGGGTTTTTTTCGGTTGGTAGG + Intergenic
1103203926 12:119113269-119113291 TTGGGTAATTTCCAGATGATTGG + Intronic
1103225172 12:119281191-119281213 TTGGGTGATTTCCAGCTTGAGGG - Intergenic
1106163472 13:27220666-27220688 TGGAGTTTTTTCCTTCTGGTGGG - Intergenic
1106600387 13:31182318-31182340 TGGGGTTTCTTCCTTCTGGTGGG + Intergenic
1106679358 13:31994224-31994246 TGGGGTTGGTTCCTTCTGGTGGG + Intergenic
1108513901 13:51179388-51179410 TAGGGTTATATCCTTCTGGTAGG - Intergenic
1109336612 13:61003063-61003085 TTGTGTTCTTTCCTTCAGGTTGG + Intergenic
1110624720 13:77640068-77640090 TGGGGTTATGTCTTGCTGGAGGG + Intronic
1112538330 13:100282909-100282931 TTTGCTTATTTCCTTCTGGGCGG - Intronic
1113480072 13:110614320-110614342 TGGAGTTAGTTCCTGCCGGTGGG - Intergenic
1114256327 14:21004375-21004397 TTGGGTCCATTCCTGCTGGGAGG + Intergenic
1115538951 14:34400882-34400904 TTTGGTTATTTCCTGTTTTTTGG - Intronic
1116901143 14:50363135-50363157 TTGAGTTTCTTCCTTCTGGTGGG - Intronic
1117003076 14:51391461-51391483 TTGCTTTGTTTCTTGCTGGTTGG + Intergenic
1117806018 14:59491633-59491655 TTTAGTTATTTCATGCAGGTGGG - Intronic
1120229594 14:81828584-81828606 TGGAGTTTTTTCCTTCTGGTGGG + Intergenic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1122434387 14:101684418-101684440 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1122965563 14:105123344-105123366 TTGGGTTATTTCCAGTTTGGAGG - Intergenic
1124639414 15:31387347-31387369 TTGGTCTTTTTCCTGCTGGAAGG - Intronic
1127714071 15:61630617-61630639 TTAGGTTATTTCTTCCTTGTGGG + Intergenic
1131992211 15:98103427-98103449 CGGAGTTTTTTCCTGCTGGTGGG + Intergenic
1132043609 15:98546294-98546316 TGGGGTTTGTTCCTTCTGGTGGG + Intergenic
1132562592 16:603992-604014 TTGGGTTATTTCCTGGTTTGGGG + Intronic
1134885523 16:17787779-17787801 TTGGGTGATTTACTGCTAGAAGG - Intergenic
1140631792 16:76862090-76862112 TGGAGTTTGTTCCTGCTGGTAGG - Intergenic
1141204314 16:81921658-81921680 TTGTGTAATTTCATGCAGGTAGG + Intronic
1143552900 17:7642124-7642146 CGGAGTTATTTCCTTCTGGTGGG - Intergenic
1147768310 17:42851401-42851423 TTGGTTTGTGTCCTGCTGGTGGG + Exonic
1148619316 17:49022525-49022547 CTGGGTGAGTCCCTGCTGGTTGG + Intronic
1149160148 17:53683467-53683489 TTGGGCTTTTTCTTGTTGGTAGG + Intergenic
1149213264 17:54327685-54327707 TGGAGTTGGTTCCTGCTGGTGGG - Intergenic
1150317266 17:64179592-64179614 TGGAGTTGGTTCCTGCTGGTGGG - Intronic
1150434276 17:65141876-65141898 TTGGGAGATTGCCTGCGGGTTGG + Intronic
1152751964 17:82066313-82066335 TTGGGTTATTTCGAGCTGTGGGG + Intergenic
1153466134 18:5389807-5389829 TGGGGTTATTTTTTGCTTGTGGG - Intergenic
1159764293 18:72468851-72468873 TTGGGTTGTTTCCCACTTGTTGG - Intergenic
1161453374 19:4358779-4358801 TTGGGTTTTTTCCTTGAGGTAGG - Intronic
1161776381 19:6264461-6264483 TCGGGCTCTTTCCTCCTGGTGGG - Intronic
1163645785 19:18488315-18488337 CTGGGTTCTATGCTGCTGGTGGG - Intronic
1163812981 19:19445828-19445850 TTGGGTTGTTTTCTGCTTTTTGG + Intronic
1164875854 19:31687909-31687931 TTGGGGTTTATCCTGCTGGGAGG + Intergenic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1166581562 19:43904818-43904840 TTGGGCAATTTGCTGCTGTTTGG - Intergenic
1167994455 19:53391020-53391042 CGGGGTTTTTTCCTTCTGGTGGG + Intronic
1168701539 19:58442535-58442557 TGGAGTTTTTTCCTTCTGGTGGG + Intergenic
925321082 2:2969340-2969362 TTGGGTTATTTTATGCTAGAAGG - Intergenic
929702934 2:44180340-44180362 TTGGTTTGTTTCCTGATGATGGG - Intronic
930575331 2:53140072-53140094 TTGGGTTATTTCTTGCTATTGGG + Intergenic
930717452 2:54606206-54606228 ATTGGTTATGTCCTGCTGGTTGG + Intronic
930858645 2:56045707-56045729 TTGGATTATTCCCTGGGGGTAGG + Intergenic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
933085733 2:78052598-78052620 TTGGGTTAATTGCAGCTTGTTGG + Intergenic
933178313 2:79201416-79201438 TTGAGTTTTTTCCTGCTTCTAGG - Intronic
936575141 2:113647090-113647112 TTGGATTATTTCCAGCTTTTTGG - Intergenic
938806240 2:134809298-134809320 TTTGCTTATTTCCTTCTGGGCGG + Intergenic
941397772 2:164994068-164994090 TTGAGTTTCTTCCTTCTGGTAGG + Intergenic
941920339 2:170844140-170844162 ATGGGATATTTTCTCCTGGTAGG + Exonic
942616528 2:177796586-177796608 TAGGCTTAGTTCCTTCTGGTTGG + Intronic
943103128 2:183510837-183510859 TTTGCTTATTTCCTTCTGGGTGG + Intergenic
945630536 2:212269827-212269849 TTGCCTTGTTTCCTGCTGGTAGG + Intronic
945658071 2:212649998-212650020 TTGGGTTTTTTTTTGTTGGTAGG + Intergenic
946887571 2:224238305-224238327 TTTGGTTATTTCAGGCTGGAAGG + Intergenic
947162738 2:227230322-227230344 TCGGGTCATTTCCTGATGGCAGG + Intronic
948552727 2:238785353-238785375 TTGTGTTATTTCCTTGTGATAGG - Intergenic
1168874071 20:1158435-1158457 TTGGGAATTTTCCAGCTGGTTGG - Intronic
1169447912 20:5687834-5687856 TGGGCTTATTTTCTGCTGGGTGG + Intergenic
1170591393 20:17774533-17774555 TTGGGTTGTTTCCTGTTTGGGGG - Intergenic
1171244596 20:23601312-23601334 TAGGGGTATATCCTGCTGGGAGG + Intergenic
1172314892 20:33946014-33946036 TTGTGTTTTTTCCTTGTGGTGGG + Intergenic
1174463816 20:50701834-50701856 TTGGCTGGTTTCATGCTGGTTGG + Intergenic
1175254326 20:57629953-57629975 TGGGGTTTCTTCCTTCTGGTGGG - Intergenic
1180123142 21:45767448-45767470 TTGGTTTTTTTCCTGCTCTTCGG + Intronic
1181868188 22:25876068-25876090 TGGGGTTATTTCCCGGTGGAAGG - Intronic
1181999210 22:26906425-26906447 TTAGGTACTTTTCTGCTGGTGGG + Intergenic
1183141125 22:35940667-35940689 TTTGGTTTTTTTCTGCTGTTTGG - Intronic
1185425038 22:50763809-50763831 TTGGATTATTTCCAGCTTTTTGG + Intergenic
950651197 3:14408030-14408052 TTGGGTTGTTTCCAGCTGGGGGG + Intronic
952922914 3:38299137-38299159 TAGGTTTATTTGCTGCTGTTTGG + Intronic
953500815 3:43432075-43432097 TTTGGTGATTTTCTGCTTGTAGG - Intronic
955219847 3:57014187-57014209 TGGAGTTTTTTCCTTCTGGTGGG - Intronic
957435328 3:80167934-80167956 ATGTGTTATTTCCAGCTAGTTGG - Intergenic
957721087 3:84000268-84000290 GTGGGATCTTTCCTGCCGGTGGG + Intergenic
958601333 3:96299893-96299915 TTTGCTTATTTCCTTCTGGGTGG - Intergenic
961932164 3:130546224-130546246 TGGAGTTTTTTCCTTCTGGTGGG + Intergenic
962020778 3:131499304-131499326 TTGGGTTATTTCTAGTTTGTTGG + Intronic
963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG + Intronic
963787278 3:149547655-149547677 TTGGGTTATTCCTTTCTGGGGGG - Intronic
964611734 3:158622656-158622678 TTGAGTTTTTTCCTGCTTGTAGG - Intergenic
964866149 3:161264113-161264135 TGGAGTTGTTTCCTTCTGGTGGG + Intergenic
964954573 3:162336596-162336618 TGGAGTTTTTTCCTTCTGGTGGG + Intergenic
966182868 3:177202975-177202997 TGGAGTTTTTTCCTTCTGGTGGG + Intergenic
966511691 3:180771364-180771386 CTGGGTTATTTCATGCTAGGTGG + Intronic
967041555 3:185698043-185698065 TTGGCTTATTTGCTGGTGCTTGG + Intronic
968066841 3:195763557-195763579 CTGGGGGACTTCCTGCTGGTCGG - Exonic
970657326 4:18246039-18246061 TGGAGTTGGTTCCTGCTGGTGGG + Intergenic
970869002 4:20792898-20792920 TTGGGTTATTTCATTCAAGTTGG - Intronic
972520298 4:39848246-39848268 TTTGTTTATTTCCTGCTGTTAGG - Intronic
973147344 4:46843922-46843944 TGGGGTTATTCCCTGGTGGCAGG + Intronic
974972069 4:68842775-68842797 TGGAGTTTCTTCCTGCTGGTGGG + Intergenic
974989083 4:69062610-69062632 ATGGTCTATGTCCTGCTGGTTGG - Intronic
975521290 4:75303641-75303663 GAGTGCTATTTCCTGCTGGTGGG - Intergenic
978177482 4:105750725-105750747 TTGGGTTATTTCCAGTTAGGGGG - Intronic
978393935 4:108258063-108258085 TTGGGTTTCTTCCTCCTGCTTGG + Intergenic
980885050 4:138753108-138753130 TTGGCTTATACACTGCTGGTGGG - Intergenic
983736890 4:171072895-171072917 TGGAGTTTTTTCCTTCTGGTGGG + Intergenic
984220607 4:176970257-176970279 ATTGGTGATCTCCTGCTGGTTGG + Intergenic
986366005 5:7032369-7032391 TTGGGTTTTTTCCTGCTTCTAGG - Intergenic
986515504 5:8558996-8559018 GTGGGTTAGTTACTGCTGTTGGG + Intergenic
986786572 5:11119980-11120002 TTTGATTATTTCCTATTGGTTGG - Intronic
990367938 5:55089059-55089081 TTTGCTTATTTCCTTCTGGGTGG + Intergenic
992434389 5:76741244-76741266 TTAGCTTATATACTGCTGGTGGG + Intergenic
992455133 5:76909616-76909638 TTTGCTTATTTCCTTCTGGGCGG - Intronic
993092519 5:83443695-83443717 TTGGGTTATTTCCAGTTTTTTGG - Intergenic
993788696 5:92178168-92178190 TTTGGTGAATTGCTGCTGGTTGG - Intergenic
994677452 5:102842934-102842956 TTGGAATAGTTCCTGATGGTGGG - Intronic
997072331 5:130635716-130635738 TTTGCTTATTTCCTTCTGGCGGG - Intergenic
998914996 5:147003266-147003288 TTTGCTTATTTCCTTCTGGGTGG - Intronic
1000175277 5:158746063-158746085 TTGGGTTATTTCCAGCTTGGGGG + Intronic
1003983827 6:11416211-11416233 CAGGGTTTTTTCCTTCTGGTGGG + Intergenic
1004607166 6:17205647-17205669 TGGAGTTTTTTCCTTCTGGTGGG + Intergenic
1004648076 6:17581824-17581846 TGGAGTTTTTTCCTTCTGGTGGG - Intergenic
1004676666 6:17849329-17849351 CTGGGTGATTTCCTTCTGGAGGG - Intronic
1005236031 6:23763369-23763391 TTTTGTTTTTTCCTGCTAGTAGG - Intergenic
1006109888 6:31738143-31738165 GTGGGTTTTCTCCTGCTTGTGGG + Intronic
1006497831 6:34436736-34436758 TTGAGTTTTTTCTTTCTGGTGGG + Intergenic
1009012482 6:57859160-57859182 TTGGTTTATTTCAATCTGGTTGG + Intergenic
1011847450 6:91584141-91584163 TTGGGTTATTCCCTGCTGATGGG - Intergenic
1011997226 6:93607322-93607344 TCTGATCATTTCCTGCTGGTTGG - Intergenic
1014862078 6:126481561-126481583 TTGGGTTAATTATTGCTGGAGGG - Intergenic
1015496047 6:133884459-133884481 TGGGATTATTTCCTGGTGGCAGG - Intergenic
1015821881 6:137270033-137270055 TGGAGTTATCTCCTGCTGCTTGG + Intergenic
1016763021 6:147760973-147760995 TTACATTATTTCCTGCAGGTAGG - Intergenic
1017887689 6:158612347-158612369 TCTGGTTACTTCCTGCTGGGTGG + Intronic
1021169499 7:17381680-17381702 CATGGTTATTTCCTACTGGTGGG - Intergenic
1026360019 7:69595213-69595235 TTGGGTTGTTTCCTGGTTGGGGG + Intergenic
1028989693 7:97035762-97035784 TGGAGTTTTTTCCTTCTGGTGGG - Intergenic
1029548843 7:101225805-101225827 TTGGGTACTTTCCTGGGGGTTGG + Intergenic
1030800677 7:113846822-113846844 ATGGGTAATTACCTGCTGGCAGG + Intergenic
1033112532 7:138594052-138594074 TTGGTTTATTCCCTGCTTCTTGG + Intergenic
1035823447 8:2619339-2619361 TTGAGTTGTTTACTGCTGTTAGG - Intergenic
1037241713 8:16785120-16785142 TGGAGTTTTTTCCTTCTGGTGGG - Intergenic
1038535368 8:28349567-28349589 TTGAGTTATCTCCTGCAGGGCGG - Intronic
1039138629 8:34357501-34357523 TTGGGTTTTTTCTGGTTGGTAGG + Intergenic
1039644656 8:39267500-39267522 TTGGGTTATTTCCAGTTTATAGG + Intronic
1040974662 8:53176855-53176877 TTACGCTATTTCCTGCTGGAAGG - Intergenic
1042690915 8:71497706-71497728 TTGGGTAAATACCTGGTGGTTGG - Intronic
1044004570 8:86925791-86925813 TGGAGTTGGTTCCTGCTGGTGGG + Intronic
1044456708 8:92398770-92398792 TTTGATTATTTCCTTCTGGGCGG + Intergenic
1044862004 8:96533064-96533086 TGGAGTTTTTTCCTTCTGGTGGG + Intronic
1046604262 8:116353395-116353417 TTTGGTTTTCTCCTGTTGGTGGG - Intergenic
1048553590 8:135455747-135455769 TTGGGTTTTTTCCGGCTGCAAGG - Intergenic
1051236881 9:15010278-15010300 TTGGTTTTTTCCATGCTGGTAGG + Intergenic
1051992895 9:23174746-23174768 TTATTTTTTTTCCTGCTGGTGGG - Intergenic
1052550017 9:29936280-29936302 CTTGGTTATTTCCTTCTGCTTGG + Intergenic
1053107346 9:35422527-35422549 TTGGCTTATACACTGCTGGTGGG + Intergenic
1056392868 9:86155154-86155176 TTTGCTTATTTCCTTCTGGGTGG + Intergenic
1057348011 9:94269097-94269119 TTGGGTTCATTCCTGCTGAGAGG - Intronic
1058604804 9:106708841-106708863 TTGCTTTATTTTCAGCTGGTGGG + Intergenic
1059304271 9:113341492-113341514 TTGGGAGATTTCCTTCTGGCAGG + Intergenic
1059778729 9:117504096-117504118 TTGGGCTTTTTCTTGTTGGTAGG + Intergenic
1185706489 X:2271190-2271212 TGGAGTTTTTTCCTTCTGGTGGG - Intronic
1187195598 X:17080523-17080545 TTAGGTTAAATCCTGCTGGTTGG + Intronic
1188093913 X:25998975-25998997 TTGCATTATTTTTTGCTGGTAGG - Intergenic
1188097436 X:26042234-26042256 TTTGCTTATTTCCTTCTGGGTGG - Intergenic
1193316352 X:80070040-80070062 TTGGGCTTTTTCTTGTTGGTAGG + Intergenic
1193318992 X:80098095-80098117 TTGAGTTTTTTCCTGCTTCTAGG + Intergenic
1193338385 X:80317715-80317737 TCTGGTTACTTCCTGCTGATGGG - Intergenic
1193346891 X:80414062-80414084 TTGAGTTTTTTCCTGCTTCTAGG - Intronic
1193664068 X:84294278-84294300 TTGGGTTACTTGCTGCTAGTGGG - Intergenic
1193974350 X:88099145-88099167 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1194155963 X:90389350-90389372 TGGAGTTGGTTCCTGCTGGTGGG + Intergenic
1194159353 X:90431918-90431940 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1196530678 X:116782743-116782765 TTGGTTTACCTCCTGCTGGGAGG - Intergenic
1196861927 X:120036804-120036826 TTGGGTAAATTCCTGCAGCTGGG + Intergenic
1200505653 Y:4008887-4008909 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1200801104 Y:7387749-7387771 TTTGCTTATTTCCTTCTGGGTGG + Intergenic
1201263859 Y:12187174-12187196 TGGAGTTGGTTCCTGCTGGTGGG - Intergenic
1201403689 Y:13629929-13629951 TTTGCTTATTTCCTTCTGGGTGG - Intergenic
1201429610 Y:13891069-13891091 TTTGCTTATTTCCTTCTGGGTGG - Intergenic
1201711098 Y:16993046-16993068 TGGAGTTGGTTCCTGCTGGTGGG - Intergenic
1201729666 Y:17190526-17190548 TTTGCTTATTTCCTTCTGGGTGG + Intergenic
1201744067 Y:17351824-17351846 TTTGCTTATTTCCTTCTGGATGG + Intergenic