ID: 963738738

View in Genome Browser
Species Human (GRCh38)
Location 3:149052869-149052891
Sequence CAGCTTTTCTGGAGAATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963738738 Original CRISPR CAGCTTTTCTGGAGAATAAA GGG Intronic
901285882 1:8078528-8078550 TTGCTGTTCTGGAGAATAATTGG + Intergenic
902121268 1:14167943-14167965 CAGCTTTTCTGGAAATTAATTGG + Intergenic
902416976 1:16245620-16245642 TTGCTTTTCTGGATACTAAAGGG - Intergenic
903805616 1:26003597-26003619 CTGCTTTGGTGGAGAATGAAGGG + Intergenic
904482226 1:30801258-30801280 CACCTTTGCTGGAGAACCAAGGG + Intergenic
905472303 1:38202637-38202659 GAGCTGTTCGGTAGAATAAAGGG + Intergenic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
906246826 1:44282157-44282179 CACCATTTCTGGAGAAGTAAGGG + Intronic
906743609 1:48206311-48206333 CAGCTTTTCTGTAGGTGAAATGG - Intergenic
909366476 1:74829208-74829230 CAGCTTTTATGGAGCAAAGAAGG + Intergenic
910203969 1:84728886-84728908 CAGCTTTGCTGAAGATTAGATGG + Intergenic
910309846 1:85810765-85810787 CAGCTTTTAAGGAGACTAGAAGG - Intronic
910972409 1:92869509-92869531 CAACTTTTGAAGAGAATAAAAGG + Intronic
912554821 1:110508343-110508365 CAGCTCTTCTGGACATTCAATGG - Intergenic
912557887 1:110529392-110529414 CAGAATTTCTGGAGCAGAAAGGG + Intergenic
912601696 1:110941564-110941586 TATCTTTTCTGGGCAATAAAAGG - Intergenic
913149268 1:116024499-116024521 CATCTTTTCTGGAGTATCATAGG - Intronic
913369460 1:118082405-118082427 CATCTTTGCTGGAGAGAAAATGG - Intronic
915055312 1:153123511-153123533 CAGCTTGTCTGAGAAATAAAGGG + Intergenic
915148822 1:153812488-153812510 CAGCTTTCCTGGAGAAAGAGAGG - Intronic
915722839 1:157996530-157996552 CAGCTTTTGAGGGGAGTAAAGGG + Intronic
915992288 1:160529939-160529961 CCCCTTTTCAGGGGAATAAATGG + Intergenic
916551624 1:165855318-165855340 CATCTTTGCTGCAAAATAAATGG - Intronic
917447797 1:175121368-175121390 CAGTTTTGCTGGAGCATAGAGGG + Intronic
918258153 1:182769015-182769037 GAGTTTTTCTGGAGAATATTTGG - Intergenic
919313787 1:195946602-195946624 CAGCTATGCTGGAGAGAAAAAGG + Intergenic
920170276 1:204067724-204067746 CAGGTATTCTGGAAATTAAATGG + Intergenic
920974791 1:210775610-210775632 CAGCAATTCTGGGGAATAGAGGG - Intronic
921979180 1:221236428-221236450 CAGGATTTCTAGAGAACAAAAGG - Intergenic
922051602 1:221995734-221995756 CAGCTTTTCTGGAATGAAAATGG + Intergenic
922315882 1:224441401-224441423 AAGTTCTTCTGGGGAATAAAGGG + Intronic
922687641 1:227657264-227657286 AAGCTTTTATGCATAATAAAAGG - Exonic
923811851 1:237326889-237326911 CAGCATCACTGGAAAATAAAGGG - Intronic
923857153 1:237857601-237857623 CAGCATTTCTGGACAGAAAACGG + Intergenic
924605003 1:245526382-245526404 CAGCTTTTCAGCAGAGTCAAGGG + Intronic
924873843 1:248078510-248078532 CAGCTGTTTTGGAAAAAAAAGGG + Intronic
1062872640 10:919473-919495 CAAGTGTTCTGAAGAATAAATGG + Intronic
1064708100 10:18093804-18093826 AAGTTTCTTTGGAGAATAAAGGG + Intergenic
1065167635 10:22996639-22996661 CAGCAGCTCTGGAGAATGAAGGG - Intronic
1065368948 10:24963127-24963149 CACCTTTTCCAGAGAATAAAGGG + Intergenic
1065795438 10:29303220-29303242 CAGATTTTGTGGAGAATACCTGG - Intronic
1065868045 10:29930749-29930771 CCACTTTTCTGAAGAATGAAAGG + Intergenic
1067873373 10:49981951-49981973 CAGAATTTTTGCAGAATAAATGG + Intergenic
1068704774 10:60062523-60062545 CAGTTTTTCCAAAGAATAAATGG + Intronic
1070436268 10:76396997-76397019 CAACTTGTCTGGAGATGAAAAGG + Intronic
1071863675 10:89702005-89702027 CGGCTTTTGTGAAGATTAAATGG + Intronic
1074492712 10:113953587-113953609 CAGCCTTTCAGGAGACAAAATGG - Intergenic
1074827867 10:117227920-117227942 GACCTCTTCTGGAGAGTAAATGG + Intergenic
1075365261 10:121882098-121882120 CAGGTTTTCTGTGGCATAAAAGG + Intronic
1076694874 10:132242616-132242638 CAGCTTTTGGGGAGACTACAGGG - Intronic
1076934093 10:133555896-133555918 CAGCTTCTCTGCAGCACAAAGGG + Exonic
1077026001 11:440242-440264 CAGCTTTGCAGAAGCATAAAGGG + Intronic
1077295990 11:1826540-1826562 CAGGTTTTCTGGGGAAGAAGAGG - Intergenic
1077559202 11:3246865-3246887 CAGGTTTTCTTTAGAATGAATGG + Intergenic
1077875645 11:6302759-6302781 AGGCTTTTCTGGAAAATAAGGGG - Intergenic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1079469116 11:20761477-20761499 CTGCTTTTCTTGAGAATACCAGG + Intronic
1081334864 11:41852603-41852625 CAGCTTCTCAGGAAAATAATTGG + Intergenic
1082035486 11:47642267-47642289 CAGCATCTCGGGAGAATGAAAGG + Intronic
1082572351 11:54759221-54759243 CAGCTTGTCTGAGAAATAAAGGG - Intergenic
1082573093 11:54766111-54766133 CAGCTTGTCTGAGAAATAAAGGG - Intergenic
1083488203 11:62996549-62996571 CAGTCTCTCTGGAGAAGAAAGGG + Intronic
1086530495 11:87779200-87779222 CAGGGTTACTGGGGAATAAAGGG + Intergenic
1087191407 11:95258282-95258304 CTTGTTTTGTGGAGAATAAAAGG - Intergenic
1087599628 11:100296717-100296739 CAGTTTTTCTGGTGTATAAAAGG + Intronic
1087934098 11:104012468-104012490 TAGCTTTGGGGGAGAATAAAAGG - Intronic
1088730232 11:112674135-112674157 CAGCTTTGCTGAAGATTAGATGG - Intergenic
1088917140 11:114236085-114236107 CTGCTGTTCTGAAGAATGAATGG - Intronic
1088959288 11:114645443-114645465 TGTATTTTCTGGAGAATAAAAGG + Intergenic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089464112 11:118672985-118673007 CTGCTTTTCTGGAAGTTAAAGGG - Intronic
1089790624 11:120940884-120940906 GATCTGTCCTGGAGAATAAATGG + Intronic
1091203491 11:133800842-133800864 CAGCCTTGCTGGTGAATGAATGG - Intergenic
1092792193 12:12079893-12079915 CTGCTTTTCTCAAGACTAAAAGG + Intronic
1093768648 12:22995041-22995063 GAGCTTTTCTGGGGAAAAAAAGG - Intergenic
1094238253 12:28192215-28192237 GAGCTTGTCTGGAGCTTAAATGG + Intronic
1095310403 12:40691924-40691946 CAGTTTTTCTTGAGAAAAGACGG - Intergenic
1096816398 12:54204456-54204478 CACCTTCTCTGGAGATTAGAGGG + Intergenic
1097588352 12:61542228-61542250 CAAGTTTTCTGAAGAGTAAATGG - Intergenic
1097608950 12:61793432-61793454 CAGATTTTATAGATAATAAAAGG + Intronic
1098622280 12:72616396-72616418 AAGCTTTTCTGGACTATAATGGG + Intronic
1099499785 12:83399709-83399731 CAGCCTGCCTAGAGAATAAAAGG - Intergenic
1099843188 12:87993288-87993310 TAGCTTTTTTGGTTAATAAAAGG - Intronic
1100014895 12:89997151-89997173 CAGCTTTTCTTTAAAAGAAAAGG - Intergenic
1104779804 12:131412858-131412880 CTGTTTTGCTGGATAATAAAAGG + Intergenic
1105022058 12:132823342-132823364 CAACATTTCTGCAGAATGAATGG - Intronic
1106135075 13:26967796-26967818 CAGCGTTTGTGGAGTAGAAAAGG - Intergenic
1106808290 13:33333779-33333801 CAACTTTTCAGGAGAAAAGATGG - Intronic
1108804718 13:54140343-54140365 TAGCGTGTCTGGAGAATAAATGG - Intergenic
1108875217 13:55039387-55039409 CAGCTGTTCTTTAGACTAAAAGG + Intergenic
1110896282 13:80756395-80756417 AAGCTTTTCTGTAAAATAAAAGG - Intergenic
1113403521 13:110017692-110017714 CAGTTTTTCTGTAGGAAAAAAGG - Intergenic
1113651327 13:112036044-112036066 CAGCTTTTCATCTGAATAAATGG - Intergenic
1115455237 14:33594479-33594501 CATCATTTCTGGAGAATATAAGG - Intronic
1116262580 14:42650641-42650663 CAGAGTTTCTGGTGAATTAAAGG - Intergenic
1116439531 14:44936502-44936524 CATCTTTTCAGTAGAATAAGAGG + Intronic
1116950689 14:50875931-50875953 CAGCTTAGCTGGAGACTAACAGG + Intronic
1117129080 14:52666621-52666643 CAACTTTTCAGGAGAAACAAAGG + Intronic
1117366253 14:55031517-55031539 CACATATTCTGGAGAAAAAAAGG - Intronic
1117743590 14:58844740-58844762 CAGCCTTTCTGGAGCCAAAAAGG - Intergenic
1118364716 14:65084887-65084909 CAGCTTTTGGGGAGAAAAAAAGG + Intronic
1121698262 14:95930448-95930470 CAACTTTTCTGGAGGAAAATGGG - Intergenic
1124469457 15:29969706-29969728 CAGCTTCTCAGGAGAATGAGGGG + Intergenic
1126379125 15:48028339-48028361 CACTTTTTCTGGCGAATAATAGG - Intergenic
1126569202 15:50131505-50131527 CAGCTCCTCTAGCGAATAAAAGG - Intronic
1127838848 15:62812497-62812519 CATTTTTGCTGGAGAATGAAAGG - Intronic
1128992877 15:72275050-72275072 CAGTTTTTATCTAGAATAAATGG + Intronic
1131554776 15:93387419-93387441 CAGCTTTTCTAGACAATGAGTGG + Intergenic
1131910134 15:97189541-97189563 CAGCTTTATTGGAGTATAATTGG + Intergenic
1133109636 16:3539929-3539951 CAGATATTCTGCAGAATAAATGG - Intronic
1133891551 16:9883947-9883969 GATCTTCTCTGGGGAATAAAAGG + Intronic
1134843946 16:17424127-17424149 CAGCTTTTCAGAAGAAGTAAAGG - Intronic
1135202299 16:20448801-20448823 CAGCTCTTGTGGGGAATAATAGG - Intergenic
1135216805 16:20579065-20579087 CAGCTCTTGTGGGGAATAATAGG + Intergenic
1135573083 16:23564204-23564226 CAAGTTTTATGGAGAATAATTGG + Intronic
1135610946 16:23866749-23866771 CAGCTATTCTGGAGAACATTTGG - Intronic
1135963340 16:27015749-27015771 CAGCTTAACTGGAAAATGAATGG + Intergenic
1136187859 16:28598650-28598672 CAGATTTCCTGCAGAGTAAAGGG - Intergenic
1136190331 16:28611644-28611666 CAGATTTCCTGCAGAGTAAAGGG - Intronic
1137532228 16:49285577-49285599 GAGATATTCTGAAGAATAAAAGG + Intergenic
1137706824 16:50541209-50541231 CAGCTTTCCTGGAGAAAGACAGG - Intergenic
1137717622 16:50608431-50608453 CAGATTTTCTGGAGTACACAGGG - Intronic
1137896474 16:52217970-52217992 GACCTTTTCAGGAGAATAACTGG - Intergenic
1138369258 16:56512072-56512094 CACCTTTTCTTGTGCATAAATGG - Intronic
1138438766 16:57021819-57021841 CAGCGTTTTTGGAGAGAAAATGG + Intronic
1139117361 16:63972909-63972931 TAACTATTCTGGAGAATACAAGG + Intergenic
1139803259 16:69541829-69541851 AAGATTTTCTGAAGAAAAAATGG - Intergenic
1139828183 16:69774228-69774250 CAGCATGTCTGGGGAATACAAGG - Intronic
1141149340 16:81553229-81553251 CTGCTTTTCTGGAAGATGAAGGG + Intronic
1142468765 17:150470-150492 CAGCCTTTCTGGAGAGGAACTGG - Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1143987090 17:10924099-10924121 CATGTTTTCTGGAGAAAGAAAGG - Intergenic
1144472242 17:15555102-15555124 CAGATTTTCTTGTGAATAATTGG - Intronic
1144924232 17:18789595-18789617 CAGATTTTCTTGTGAATAATTGG + Intronic
1146603594 17:34239003-34239025 CTGGTTTTCTAGAGAACAAAGGG - Intergenic
1148401029 17:47361395-47361417 AAGATTTTCTGTAGGATAAAAGG + Exonic
1150233494 17:63573365-63573387 CAGCCTTTGTGGAGGAGAAACGG - Intronic
1150844379 17:68640283-68640305 CAGCTTTTCTGCAGTAGAGACGG - Intergenic
1152849433 17:82623977-82623999 CAGCCACTCTGGAAAATAAACGG + Intronic
1153353327 18:4106697-4106719 CAACTTTTCTGAAGAAACAAAGG - Intronic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1156562135 18:38137287-38137309 CAGCTTTGTTGGAGATTAGATGG - Intergenic
1157679692 18:49595012-49595034 CAGCTTGTTTGGAGAGTCAAAGG - Exonic
1157685678 18:49640701-49640723 CAGCCTGTCTTGAGAACAAAGGG - Intergenic
1157826081 18:50813646-50813668 TAGCTTCTCTCCAGAATAAAGGG + Intronic
1159474096 18:68896087-68896109 AAGCTTATCCAGAGAATAAATGG + Intronic
1159925470 18:74265237-74265259 CAGTTTTTCTGCAGCATAGATGG - Intronic
1161516271 19:4698297-4698319 CAGCATCTCTGGAGGATCAAAGG + Intronic
1163328899 19:16623421-16623443 CTGCTTTTCTGCAGAATAAATGG + Intronic
1164727723 19:30477743-30477765 GAGCTTATCAGAAGAATAAAAGG + Intronic
1164786301 19:30933797-30933819 CACATTTTCTGGAGAATCACAGG + Intergenic
1166199216 19:41225933-41225955 CAGCTTTTCCAGAGAATGAGAGG - Intronic
926487841 2:13485058-13485080 TAGCTTTTCTGAAGAGTAAAAGG + Intergenic
927244067 2:20942697-20942719 CAGCTCTGCTGGAGAAGGAAGGG - Intergenic
927368781 2:22330435-22330457 CAGTTTTTCTGTAGCACAAAAGG + Intergenic
927825046 2:26302611-26302633 CACCTTTTCTGGAGCCTATATGG - Intergenic
929200790 2:39233362-39233384 CACCATTTTTGGGGAATAAAAGG + Intergenic
930354029 2:50294645-50294667 AAGATTTTCTGGAGAAGGAATGG + Intronic
930500202 2:52206227-52206249 CATTTTTTGTGGTGAATAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931575533 2:63714370-63714392 AGGATTTTCTGAAGAATAAAAGG - Intronic
934142358 2:89059707-89059729 TATCTTTTCTGGTGAAAAAAAGG - Intergenic
934226881 2:90140847-90140869 TATCTTTTCTGGTGAAAAAAAGG + Intergenic
936153081 2:110032247-110032269 CAGCTTTCCTGGAGAAGTTAAGG - Intergenic
936191599 2:110339165-110339187 CAGCTTTCCTGGAGAAGTTAAGG + Intergenic
936434249 2:112489915-112489937 CAGATTTTCTTGAAAATAAAAGG - Intronic
937449555 2:121990819-121990841 CATCTTATCTGGATAATACACGG - Intergenic
938628083 2:133133604-133133626 CAGCTTTTCTTCAGAAAAACAGG - Intronic
939120070 2:138105689-138105711 CATCTCTTCTGGAAAATAAAAGG + Intergenic
939640873 2:144638658-144638680 CCCCTTTTCAGGAGAATGAATGG + Intergenic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940696633 2:156986923-156986945 CTGCTTCTCTGCAAAATAAAGGG + Intergenic
940856057 2:158729569-158729591 CAGCTTTGCAGGAGCAGAAAGGG + Intergenic
941771106 2:169347009-169347031 TTCCTTTTCTGGGGAATAAAGGG - Intronic
943012494 2:182467229-182467251 CAGATTTTATGGACAGTAAAAGG + Intronic
943305909 2:186262280-186262302 AAGATTTTCTGGAGAATAGCTGG - Intergenic
943493994 2:188595997-188596019 CAGATTTTCTTGATCATAAATGG + Intergenic
943730329 2:191296160-191296182 CACTTTCTCTGGTGAATAAATGG - Exonic
943941583 2:194004422-194004444 GAGATTTTCTAGAGAATACAGGG - Intergenic
944543368 2:200775650-200775672 CAGCATTTCTGGAGTAAAATAGG - Intergenic
945608268 2:211964226-211964248 CTCCTCTTCTGGAGAATGAATGG + Intronic
945725124 2:213465654-213465676 CAGGTTTTGTGGGGTATAAATGG + Intronic
945797337 2:214381063-214381085 CAACTTTCCTGGGGAAAAAAAGG - Intronic
947844302 2:233231851-233231873 CTGCTTTCCTGGAAAATAAGTGG - Intronic
1168982830 20:2022569-2022591 CAGCTTTTACTGAGCATAAAAGG - Intergenic
1169023996 20:2351896-2351918 CCCCTTTTCTGGAGAATCACAGG + Intergenic
1169317609 20:4606264-4606286 CAGCTATTCAGGAGACTGAAGGG - Intergenic
1170371209 20:15650225-15650247 CAGGTTTTCTTAAAAATAAATGG + Intronic
1170663580 20:18365623-18365645 TAGATTATCTAGAGAATAAAGGG - Intergenic
1172288373 20:33757281-33757303 CAGCGTTGCTGGAGAGTCAAAGG - Exonic
1172330459 20:34072355-34072377 CAGCTATTCTAGAGAATACTAGG - Intronic
1172478165 20:35254216-35254238 CAGCTTTGCTGGAGATCAAATGG + Intronic
1174189613 20:48730881-48730903 CAGCTTCTCAGAAGACTAAATGG + Intronic
1174373795 20:50112482-50112504 CTGCTTTTGGGGAGAATGAAGGG - Intronic
1175588359 20:60165905-60165927 CTGCTTCTCTACAGAATAAAAGG - Intergenic
1176277164 20:64278987-64279009 CACCTTTCCTAGAGATTAAAGGG + Intronic
1177306025 21:19317152-19317174 CTGCTTTTCTGGGGTATGAAGGG + Intergenic
1179315825 21:40243747-40243769 GAGCATTTCTGGAGGAGAAAAGG + Intronic
1179351394 21:40614510-40614532 CAACTTTTATGGAGGATAACTGG + Intronic
1179489401 21:41730410-41730432 CAGCTTTCATGGAGGAGAAAAGG - Intergenic
1179648120 21:42788008-42788030 CAGCTGTTCTTTATAATAAAGGG - Intergenic
1185240947 22:49746516-49746538 CAGGTTTACTTGAGAAGAAAAGG - Intergenic
949133776 3:537340-537362 CAGATTTACTGAATAATAAAAGG + Intergenic
949866580 3:8552324-8552346 CAGATATTCTGGACCATAAAAGG + Intronic
949936253 3:9118600-9118622 ATGTTTTTCTGGGGAATAAATGG - Intronic
950958935 3:17084112-17084134 CAGATTTTATGGACACTAAAAGG + Intronic
951229062 3:20155682-20155704 CAGCTATTCTGGAATATCAAAGG + Intergenic
951258391 3:20478373-20478395 CTGGTTTTATTGAGAATAAAAGG + Intergenic
952159006 3:30674814-30674836 CAGCTTTTCAGGAGAAAAGTAGG - Intronic
952408198 3:33024436-33024458 CTGCTTTTTTGGAAAATCAAAGG + Intronic
955560392 3:60182833-60182855 CAGCATTTATAGAGAATAAAAGG - Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
955810270 3:62780521-62780543 GAGTTTTTCTGGAGAATGAGAGG - Intronic
956002189 3:64741297-64741319 CAGCTCTTGTAGAGAATAGATGG + Intergenic
956037825 3:65114705-65114727 CAGCTTTTCTTGAAAGTGAATGG - Intergenic
956175540 3:66470105-66470127 CAGCTTTTCTTGAAAATAATCGG + Intronic
956522928 3:70125406-70125428 CAGAATTTCTAGAGAAGAAATGG - Intergenic
956565465 3:70632197-70632219 CAGCTATTCAGGAGAATAGCTGG - Intergenic
957377699 3:79380139-79380161 CAACTTTCATTGAGAATAAAAGG + Intronic
958483108 3:94669575-94669597 CAGCTTTCATGGAAAATAATAGG - Intergenic
958523298 3:95219463-95219485 TTGCTTTTCTGTAAAATAAAAGG - Intergenic
959395680 3:105834854-105834876 CAGCATTTCTGAAGAATATAGGG - Intronic
960176150 3:114519709-114519731 AAGCTTTTCTGGAGAGATAAAGG + Intronic
960573061 3:119204494-119204516 GAATTATTCTGGAGAATAAAAGG - Exonic
961116284 3:124332784-124332806 CTGCTTTTCAGGAGAAAGAAAGG + Intronic
961677100 3:128574296-128574318 CAGATTTTCTGCAGGAAAAATGG + Exonic
962807936 3:138939906-138939928 CTGCTTTTCTGAAAAAGAAAAGG + Intergenic
963362528 3:144293180-144293202 CAGCATTTCTAGAACATAAAAGG - Intergenic
963383117 3:144557104-144557126 CAGCTTTCCTGTAGAATATTTGG + Intergenic
963738738 3:149052869-149052891 CAGCTTTTCTGGAGAATAAAGGG + Intronic
963925461 3:150945977-150945999 CAGCATTTCTTGATAATAAGAGG + Intronic
964728558 3:159840365-159840387 TAGCTTTTCTGGGGAGTAATGGG + Intronic
965239974 3:166183575-166183597 TAGCATTTGTTGAGAATAAAAGG - Intergenic
965428602 3:168559127-168559149 CAGCATTTGTGGATAAAAAATGG + Intergenic
965912372 3:173794601-173794623 AAGCATTTCTCCAGAATAAAAGG + Intronic
966356577 3:179086106-179086128 CATGTGTTCTGGAGAATAACTGG + Intergenic
967480088 3:189962689-189962711 TAGCTCTTCTGTACAATAAAAGG + Intronic
968281662 3:197481675-197481697 CAGCTTTTCTGAAGAACATGAGG - Intergenic
968402943 4:314648-314670 CAGCTTTTTGGTAGAATAATTGG - Intergenic
970606705 4:17688141-17688163 CAGCCTGCCTGGAGGATAAAGGG - Intronic
970898237 4:21128196-21128218 CAGCTTTCATAGAGAGTAAAAGG + Intronic
971133973 4:23846412-23846434 TTGCTTATCAGGAGAATAAAAGG + Intronic
973043017 4:45497681-45497703 CAGCTTGTCTGAGAAATAAAGGG + Intergenic
974120803 4:57636273-57636295 CAGCATTTTTGCAGAAAAAAAGG - Intergenic
975018208 4:69451509-69451531 CAGGTTTTATGGAGATTCAAAGG + Intergenic
976000459 4:80368337-80368359 CAGATATACTTGAGAATAAAGGG - Intronic
976373374 4:84315930-84315952 AAGCAATTCTGGAGAAAAAATGG + Intergenic
977319397 4:95492986-95493008 TAGCTTTTCTGTAGTTTAAAAGG - Intronic
977396253 4:96474713-96474735 CAGTTTTTCTGGTGAATCATAGG - Intergenic
977695612 4:99961786-99961808 CAGCTTAGCTGGGGAAAAAAGGG - Intergenic
979469785 4:121081503-121081525 CATTTTTTCTAGAAAATAAATGG + Intergenic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
980456503 4:133050767-133050789 CAACTTTTTTGAAGAACAAATGG - Intergenic
980783488 4:137521819-137521841 CAGCTTTTGTGTATAATAATAGG - Intronic
981910022 4:149968101-149968123 CAGTTTTTCTGGAGGATCAAGGG - Intergenic
982867221 4:160529007-160529029 TACCTTTTCTGGGCAATAAATGG - Intergenic
983302422 4:165944448-165944470 CAGTGTTTCTGGAGCATAATGGG + Intronic
984406790 4:179342798-179342820 CATCTTATCTGGGGAAAAAAGGG - Intergenic
985246418 4:187983863-187983885 CAGCTTTACTGGGGAGTAAATGG + Intergenic
985818006 5:2140829-2140851 TAGCTTGTTTGGAAAATAAAAGG - Intergenic
987029818 5:13965280-13965302 CAGTTTATCCAGAGAATAAAAGG - Intergenic
987458675 5:18178976-18178998 AAGCTATTCTGGAGAGCAAAGGG - Intergenic
988114344 5:26865536-26865558 CAGTGTTTGTGGAGAATAATAGG + Intergenic
988785661 5:34563811-34563833 AAGCTTTTCTGGAAAAGTAATGG + Intergenic
988984843 5:36607387-36607409 CAGCTGTTCTGAAAAATCAAGGG - Intronic
992013112 5:72550497-72550519 CAGCTGTTTTGGAGAATAGGGGG - Intergenic
994101239 5:95895003-95895025 TAGCTTTTTTGCAGAATAAAAGG - Intronic
994710450 5:103258931-103258953 CACCTTTTCTGCAGCACAAAAGG - Intronic
995486360 5:112644102-112644124 CAGGTTTTCTGGGCAATAACTGG - Intergenic
995786208 5:115831280-115831302 CATCTTTGCTGGGGAATAATAGG - Exonic
995825121 5:116288507-116288529 GAGCTTATCTGAAGAAAAAATGG - Intronic
996645041 5:125803980-125804002 TAGATTTTCTAGAAAATAAATGG + Intergenic
997405643 5:133644582-133644604 CAGCTTTGGTGGAGAAGACATGG + Intergenic
997901390 5:137768540-137768562 CAGCTGGTCTGGGAAATAAAGGG - Intergenic
997930592 5:138069512-138069534 CAGCTTTCCTAGAGAAAACAAGG - Intergenic
998511215 5:142715719-142715741 CAAATTTTCTAGAGAATAATTGG + Intergenic
1000687369 5:164269004-164269026 CAGGTTTTCTGAATAATAAGGGG - Intergenic
1001652172 5:173323773-173323795 CAACTTTTCTGGAACACAAAGGG + Intronic
1001988869 5:176099437-176099459 CAGCTGTGGTGGAGGATAAATGG - Intronic
1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG + Intronic
1003722435 6:8718678-8718700 CAGTATTTCTGGAGAAAAGAAGG - Intergenic
1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG + Intronic
1004397550 6:15259188-15259210 CATCTTGCCTGGAGAATAAAAGG - Intronic
1004879480 6:19993126-19993148 CGGTTTTGCTGGAGCATAAAAGG + Intergenic
1005559571 6:27024473-27024495 TACCCTTTCTGGAGAATAAAAGG + Intergenic
1008469073 6:51862736-51862758 CACCTCTCCTGGAAAATAAAAGG - Intronic
1011773430 6:90701130-90701152 CAGTTTTTCTGGAGAAAATTGGG + Intergenic
1011991802 6:93529967-93529989 CAAATTTTCTGGAAAATTAAAGG + Intergenic
1015314199 6:131798551-131798573 CAGTTTTTCAGGAGTAAAAATGG - Intergenic
1016630668 6:146226468-146226490 CATCTTTCCTGAAGAACAAAGGG - Intronic
1017454984 6:154593550-154593572 AAGCTTCTCTGTGGAATAAATGG - Intergenic
1017603145 6:156105134-156105156 CAGCTTTCCTGGAAAATTACTGG + Intergenic
1019110644 6:169709509-169709531 CACCTTTTCTTCAGAAGAAAAGG + Intronic
1019188413 6:170235366-170235388 CAGCCTTTGTGGAGAACCAAAGG + Intergenic
1020542620 7:9478282-9478304 CAGTTTTTCTCTAGAACAAAAGG + Intergenic
1020817720 7:12926327-12926349 CAGCTTTCCAGAAGAATTAAGGG + Intergenic
1022964980 7:35464362-35464384 CAGCATTTCTGGGGAAAAGAGGG + Intergenic
1023006935 7:35880464-35880486 CAGCCTTTCGGGAAAATAAAAGG - Intronic
1024067258 7:45750686-45750708 CAGCCTTTCTGGAAAATAAAAGG + Intergenic
1024743515 7:52381228-52381250 CAGCTTTACTGAAGTATAACTGG - Intergenic
1024835664 7:53515072-53515094 CATATTTTATGTAGAATAAAAGG + Intergenic
1027808274 7:82858483-82858505 CATCTATACTGGAGAAGAAAAGG + Intronic
1028007930 7:85601107-85601129 CAGATATTCTGGAGTATAATTGG - Intergenic
1028802361 7:94981046-94981068 CAGCTGTGCTAGAGAATAATGGG + Intronic
1029213883 7:98931178-98931200 CAGCTTATCTGGTGAATGCAGGG + Intronic
1031337275 7:120551136-120551158 GAGATTCTCTGGGGAATAAAGGG + Intronic
1032810548 7:135410919-135410941 ATGCTTTTCTGTACAATAAATGG - Intronic
1034032975 7:147788417-147788439 TAGCTTATCTGGAAAATAAGTGG - Intronic
1034406952 7:150910832-150910854 GAGCATTTCTGCAGAAAAAAGGG + Intergenic
1036706229 8:11049091-11049113 AAGCTTTTCTGGGGAGGAAAGGG + Intronic
1037605875 8:20436712-20436734 CAGCTTTCCTGGTGAGTGAATGG + Intergenic
1039027522 8:33273897-33273919 TGGCTCTTTTGGAGAATAAATGG - Intergenic
1039237339 8:35516353-35516375 CAGATTTTCAGGAGAAAAACAGG - Intronic
1039246179 8:35611129-35611151 CATCTTTTTGGGAGAATCAAAGG - Intronic
1039246306 8:35612606-35612628 CATCTTTTTGGGAGAATCAAAGG + Intronic
1039270954 8:35879705-35879727 CAGCTATTCTGTAGACTGAAAGG + Intergenic
1041542904 8:59007191-59007213 CAGCTCTGCTGGAAAATAAGGGG + Intronic
1041828190 8:62122407-62122429 CAGCTTGTTTTAAGAATAAAAGG + Intergenic
1042475462 8:69244341-69244363 CAGCTGATCTAAAGAATAAATGG + Intergenic
1042843272 8:73146268-73146290 CAGCTCTTCAGTAGAAAAAAAGG + Intergenic
1042925769 8:73967039-73967061 GAGCTGTTCTGAAGAATAAATGG + Intronic
1043619697 8:82174530-82174552 CAGCATTTCTGGAGTAAGAAGGG + Intergenic
1044076342 8:87826218-87826240 TAGGTTTTTTGGAGAACAAATGG + Intergenic
1046975995 8:120278367-120278389 TTGTTTTTCTGGAGAAGAAAGGG - Intronic
1047962640 8:130022049-130022071 CAGCTTTTCTTGAGGATTTAAGG - Intergenic
1048106130 8:131411911-131411933 CAGTTTTGCTGGAGAAAGAAAGG + Intergenic
1048213156 8:132473881-132473903 CAGCTGCTCTGGAACATAAAGGG - Intronic
1051986809 9:23098950-23098972 CAGCTTTTCTGGAGAAATTAAGG + Intergenic
1052774750 9:32722197-32722219 GAGCTGTTCTGCAAAATAAAGGG + Intergenic
1053177227 9:35936431-35936453 CAGCTTTCCAGGAGACCAAATGG + Intergenic
1054842222 9:69755461-69755483 CAACTTTTGTGGATAATAAGTGG - Intronic
1055217636 9:73885843-73885865 CAGCTTTGTTGAAGAACAAATGG + Intergenic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057315201 9:93963910-93963932 CAGCTTTACTGAAGTATAATTGG - Intergenic
1057644654 9:96861495-96861517 CAGCTGTTTGGGAGAATTAAGGG + Intronic
1057824753 9:98363892-98363914 TAGCTTTTCTGGAGAGTGAGGGG - Intronic
1058073330 9:100624173-100624195 CAGCTTTTCTGAAGCAAAATTGG + Intergenic
1058923389 9:109639544-109639566 ATGCTTTGATGGAGAATAAAAGG - Intergenic
1061572283 9:131485178-131485200 CCGTTTTTCTTGATAATAAATGG - Intronic
1061724056 9:132571790-132571812 CACCATTTCTTGAGAAGAAAGGG + Intronic
1061724782 9:132576129-132576151 CACCATTTCTTGAGAAGAAAGGG + Intergenic
1062376087 9:136262506-136262528 CAGCTTTTCTGAGGAGGAAATGG - Intergenic
1186675515 X:11812749-11812771 CAACTTTTCTTTAGATTAAAAGG - Intergenic
1187023147 X:15405954-15405976 CATCCTTTTTGGAGAATAAAAGG + Intronic
1187349195 X:18496457-18496479 CAGCTTTCAGGGAGAATAGATGG + Intronic
1187734623 X:22291138-22291160 TAGGTTTTCTGGAGGAGAAATGG - Intergenic
1188340931 X:29000584-29000606 AATCTTTTTTGTAGAATAAAAGG - Intronic
1188780701 X:34280365-34280387 CAGCTTATCTGGAGAGCAGATGG - Intergenic
1189100907 X:38188610-38188632 CAGCTTTACTGGGGTATAATGGG + Intronic
1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG + Intergenic
1189709317 X:43793418-43793440 GAGCCTTTCTGGAGGAAAAAGGG - Exonic
1191764701 X:64684863-64684885 CAGCTTTTCAGAAGTCTAAAGGG + Intergenic
1192559315 X:72115338-72115360 CAGCTTTTCAGGACAGTAAGGGG - Intergenic
1193160633 X:78225164-78225186 CAGCTACTCTGGAGACTAGATGG + Intergenic
1193299498 X:79872666-79872688 CAGCTTTTTTGAAGACTAGATGG - Intergenic
1195535573 X:106005495-106005517 CAGCATTTTTGAAGAGTAAAAGG + Intergenic
1195577240 X:106464990-106465012 CAGCTTATCTGGAGACCACATGG - Intergenic
1198078159 X:133213880-133213902 GAGCTATTCTGGAAAATAATTGG - Intergenic
1201986943 Y:19978943-19978965 CAGTTTTTCTTGGGACTAAATGG + Intergenic