ID: 963738880

View in Genome Browser
Species Human (GRCh38)
Location 3:149054536-149054558
Sequence TTGGAATCCCTGTGAATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963738880_963738882 24 Left 963738880 3:149054536-149054558 CCTTATATTCACAGGGATTCCAA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 963738882 3:149054583-149054605 AGAAGTTTGAAGCTCAAACTAGG 0: 1
1: 0
2: 0
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963738880 Original CRISPR TTGGAATCCCTGTGAATATA AGG (reversed) Intronic
900904284 1:5540675-5540697 TTGGAAACCCTATAAATACATGG - Intergenic
908048661 1:60202418-60202440 TTGAATTCCATGTGAATAGAGGG - Intergenic
910728259 1:90361006-90361028 TTGGATTGCCTGTGATTCTAAGG - Intergenic
911358186 1:96846566-96846588 TAGGAAAGCTTGTGAATATATGG + Intergenic
915361113 1:155286888-155286910 GTGGAATCACTGGGAATTTAGGG + Intronic
918155475 1:181841726-181841748 TTGGTATCAATGTGAATTTATGG + Intergenic
918652735 1:186985810-186985832 TTGGAATCCCAATGAATTTCAGG + Intronic
920591848 1:207227398-207227420 TTGGAATTCCTGTGTGTTTATGG + Intergenic
924537095 1:244944915-244944937 TTGGAAACCCTGTGAATGGCTGG + Intergenic
1063078163 10:2737217-2737239 TTGAAATCCCTGTGATTACTAGG + Intergenic
1066642434 10:37569552-37569574 TTGGAAGCAATATGAATATACGG - Intergenic
1066676770 10:37896230-37896252 TGAGAAGCCCTGTGAATGTAAGG + Intergenic
1069853859 10:71428079-71428101 TTGGAATTCCTGTGCATTTCTGG - Intronic
1073506629 10:103999625-103999647 TTGGCATACTTGTGAGTATATGG + Intronic
1075703901 10:124487286-124487308 TTGCAATCCCTCTGAAAAAAAGG - Intronic
1077736166 11:4793888-4793910 TGGGAATCACTGTGAGTGTATGG + Intronic
1080692324 11:34568613-34568635 TTGGAATCCCAGTTAATAGATGG + Intergenic
1081120645 11:39261357-39261379 TTCGCAACCCTTTGAATATAAGG - Intergenic
1081529354 11:43947420-43947442 TTGGAATGCCTGTGAGCACAGGG - Intergenic
1082672057 11:56046191-56046213 TTGGATTTCCTTTGAATACAGGG - Intergenic
1085904868 11:80748251-80748273 TTAAAATCCTTGTAAATATAAGG - Intergenic
1088756411 11:112888941-112888963 TTGGGATCTCTGTGAATGTATGG + Intergenic
1093001796 12:14005387-14005409 TTGAAAACCATGTGAATACATGG - Intergenic
1093350570 12:18095059-18095081 TTGGAATCCAAGTGAAAGTACGG - Intronic
1099722072 12:86376521-86376543 TTAGAATCCCAATGAATATTTGG + Intronic
1100025965 12:90128428-90128450 TTGGAGGCCCAGTGAATAAAGGG + Intergenic
1100867627 12:98874001-98874023 TTGGAAACACTGTGAAAAGATGG + Intronic
1103091303 12:118100019-118100041 TTGGAATCTCTGTCATTAGATGG - Intronic
1104048353 12:125179604-125179626 TTCGAATTCCTGTGAATGTACGG - Intergenic
1104074632 12:125378183-125378205 TTGAAATACCTGTGGATATAGGG + Intronic
1106317541 13:28608053-28608075 TCCGCATCACTGTGAATATATGG + Intergenic
1108514769 13:51190442-51190464 CTGGATTCCCTGTGAAAGTAGGG + Intergenic
1110038757 13:70723655-70723677 TTCGAATCCCTGTGCATTTCTGG - Intergenic
1110762523 13:79246006-79246028 TGAGAATACCTGTGAATATCTGG - Intergenic
1110920922 13:81084283-81084305 TTTGAATTCCTGTGAATGTGAGG + Intergenic
1111818031 13:93179198-93179220 TTTGAATCCCTGTGAATCCCAGG + Intergenic
1116643823 14:47500720-47500742 TTAGTCTCCTTGTGAATATATGG - Intronic
1129979985 15:79859853-79859875 TTTGAATCCCTATGTATACAGGG - Intronic
1137055427 16:35744072-35744094 TTGGAATGCCTGTATATATTTGG + Intergenic
1141765382 16:86054951-86054973 TTGGTTTCCCTGTGATTATTCGG - Intergenic
1144612207 17:16730477-16730499 TTTGATTCCCTGTGAATTTTAGG + Intronic
1144900523 17:18584816-18584838 TTTGATTCCCTGTGAATTTTAGG - Intergenic
1145131923 17:20360865-20360887 TTTGATTCCCTGTGAATTTTAGG + Intergenic
1149954423 17:61032537-61032559 TTGCATTACCTGAGAATATAAGG - Intronic
1150468638 17:65416890-65416912 TTGGAATCGCTGTTACTATAAGG - Intergenic
1150548402 17:66186713-66186735 TTGGAAGCCATCTGACTATAAGG - Intronic
1155616866 18:27731895-27731917 TTGGAGTTACTGTAAATATATGG + Intergenic
1157647074 18:49285453-49285475 ATGGAATCACTTTGAATATGTGG - Intronic
1158357533 18:56638155-56638177 TAGGAACCCCTGTGCATAAATGG + Intronic
1158925882 18:62259582-62259604 TTGCAATCCCTATCAAAATATGG + Intronic
1159230285 18:65598455-65598477 TTGGAATATATTTGAATATAGGG - Intergenic
1165536275 19:36449039-36449061 TGAGAAACCCTATGAATATAGGG - Exonic
1165688809 19:37846258-37846280 TAGGTATCCCTGTGAATTTGGGG - Intergenic
925661515 2:6208309-6208331 TTGTAATCCCTGGGAGTAGAGGG + Intergenic
929370335 2:41215878-41215900 TTGGGTTCCCTGTGAATTTTAGG + Intergenic
933440958 2:82313263-82313285 TTTGGAACCCTGTGAATATACGG + Intergenic
933544484 2:83693488-83693510 TTGGCATCTCACTGAATATAGGG + Intergenic
935023846 2:99257504-99257526 TTGGTATCCCTGGGAAGAGATGG - Intronic
935520188 2:104095134-104095156 TTGGAAGCCATGTGGATATCTGG - Intergenic
935590249 2:104841792-104841814 TTAGAATCCCTCTGAATCTCAGG + Intergenic
936248386 2:110848334-110848356 TTGGCAACCCTGTGTATATCTGG - Intronic
936984717 2:118297999-118298021 TTGGAGGCTCTGTGTATATAGGG + Intergenic
938508437 2:131912520-131912542 TTTGAATCTTTGTGAATGTATGG - Intergenic
940846842 2:158651274-158651296 TTTGAATACGTGTGAAAATATGG - Intronic
941469667 2:165868968-165868990 TTGGAAGCCCTGCGAATGGAAGG - Intronic
942052634 2:172154869-172154891 TTTGAGTCCATGTGAATATATGG + Intergenic
943391742 2:187278232-187278254 TTGGCATCCCTGTAAAAAGAGGG - Intergenic
947300351 2:228682274-228682296 TTGGAAGCCCTGTTACTAGAAGG + Intergenic
948172144 2:235912637-235912659 TTGGAATAACTGTCCATATATGG + Intronic
948755506 2:240157519-240157541 ATGGAATCCCTGTGATTGTAGGG + Intergenic
1173127563 20:40353931-40353953 TTGGGTTCCCTGTCCATATATGG + Intergenic
1174619320 20:51862227-51862249 TTGCAAACCCTGTGAATCTGAGG - Intergenic
1176785055 21:13246049-13246071 TTTGAATCTTTGTGAATGTATGG + Intergenic
1177297829 21:19200213-19200235 TGGGAATTCATGTGAATATTGGG - Intergenic
1182742203 22:32576149-32576171 TTGGGAGCCCTGTGGATATGTGG - Intronic
1183919646 22:41155103-41155125 TAGGAATCCCTGTAAGTATTTGG + Exonic
1184079454 22:42208754-42208776 TTATAATTCCTGTTAATATAAGG - Intronic
949798270 3:7875177-7875199 TTGGAATCCATGAGTCTATATGG + Intergenic
951402911 3:22256531-22256553 TTGGAATCTATGTGGGTATAAGG + Intronic
953898652 3:46824533-46824555 TTGTAATCCCTGTGTGTCTATGG - Intergenic
954050150 3:47968364-47968386 TTTCAATCCCTTTCAATATATGG - Intronic
955921976 3:63966635-63966657 TCTGAATCCTTGTGAAAATAGGG + Intronic
956260455 3:67334863-67334885 TTGGACTGAGTGTGAATATATGG - Intergenic
956891357 3:73617244-73617266 TTAAATTCCCTGTAAATATATGG + Intronic
957853402 3:85841504-85841526 GTGGACTCCCTTTGAATATAGGG - Intronic
958106919 3:89086546-89086568 TTGGAATACTTATAAATATATGG - Intergenic
960095054 3:113681448-113681470 TTGGAAACTATGTGAATACAGGG - Intronic
963738880 3:149054536-149054558 TTGGAATCCCTGTGAATATAAGG - Intronic
964287627 3:155136727-155136749 TTGCACTCACAGTGAATATATGG + Intronic
964705921 3:159618504-159618526 TTGGAAACCCTGAAAATCTACGG + Intronic
965448195 3:168802145-168802167 TTAGAATCCATGTTAAAATATGG - Intergenic
965949544 3:174290090-174290112 TTGGAATAGCCGTGAATTTAAGG - Intergenic
965975558 3:174616034-174616056 ATAAATTCCCTGTGAATATAAGG + Intronic
970342173 4:15118735-15118757 TTGGAAACATTGTGAATAAATGG - Intergenic
970435026 4:16025120-16025142 TTGGAGTTCCTGTGTATATTTGG - Intronic
970574046 4:17410463-17410485 TTGGAACCCTTGTGTATAAATGG + Intergenic
973864749 4:55101103-55101125 TCGGAATCCTTGTGACTATCTGG + Intronic
973931820 4:55800975-55800997 TTGGAAGCGCTGTGCAAATAAGG - Intergenic
974117325 4:57595935-57595957 TTGCAATACCTGTTGATATATGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975978916 4:80132999-80133021 TTGGAATCCATATGGATTTAAGG - Intergenic
979217082 4:118178797-118178819 TTGGAATCCCTGTGCACTGATGG - Intronic
980138794 4:128890507-128890529 TTGGAATTTCTCTGAATATATGG - Intronic
982383010 4:154770200-154770222 TTGTAATCCCTGTGAGTCCAGGG - Intergenic
982527293 4:156494655-156494677 TTGAAATCTCTTTGAAAATAGGG - Intergenic
983225877 4:165085819-165085841 TTCTAAGCCCTGGGAATATAGGG + Intronic
983258358 4:165427796-165427818 TTAGAATCTCTGTGAATCTCAGG + Intronic
987130648 5:14856951-14856973 TTTGCTTCCCTGTGAACATATGG - Intronic
989349274 5:40467034-40467056 TTGGAAAACTTGTGAATATGAGG + Intergenic
994388551 5:99162183-99162205 TTGTAATTTCTGGGAATATAGGG + Intergenic
998356808 5:141545193-141545215 TTGGAGTGACTGTGATTATATGG + Intronic
998733696 5:145110402-145110424 TGAGAAGCCCTTTGAATATAAGG + Intergenic
998827918 5:146123671-146123693 TTGGAAAGCATTTGAATATAAGG + Intronic
999208906 5:149870679-149870701 TTGGGACCCCAGTGCATATAAGG - Intronic
1000235028 5:159349850-159349872 TTGGAAAACCCGTGATTATAGGG + Intergenic
1001026592 5:168229617-168229639 TTGGAATCCCTGAGAGTAGAAGG + Intronic
1003342228 6:5232901-5232923 TTAGCATCCATGTGAATGTAGGG + Intronic
1004405997 6:15334273-15334295 TAGGAACCCCTGTGATTACAAGG - Intronic
1005121242 6:22391572-22391594 TTGGAATTCCTGTGCATGGAAGG - Intergenic
1008401753 6:51071302-51071324 TTGGAATCCCAAGGAAAATATGG - Intergenic
1008750647 6:54729824-54729846 TTGGAATCACTGTTAATAGAGGG + Intergenic
1009293414 6:61912944-61912966 TTGGAATCACTCTCAATATGAGG + Intronic
1011996556 6:93596638-93596660 TTGGTTTCCTTGTGAATTTAAGG - Intergenic
1012353435 6:98282130-98282152 ATGGAATTCCTGGGAATAGAGGG - Intergenic
1013036965 6:106394241-106394263 TTGGAAAACCTAAGAATATAAGG - Intergenic
1013727328 6:113114910-113114932 GTGGAATTTCTTTGAATATAAGG - Intergenic
1013885132 6:114955001-114955023 TTGGAAACTTTGTAAATATATGG - Intergenic
1013900463 6:115150049-115150071 ATGGAAACCCTGAAAATATATGG + Intergenic
1016056372 6:139581815-139581837 TTGCAATCCCTGAGAATTTTTGG - Intergenic
1023473305 7:40549083-40549105 TTGGAACACTTGTGAATGTATGG + Intronic
1024387337 7:48767685-48767707 TTGGAAATTCTGTGAAAATATGG - Intergenic
1024427426 7:49242790-49242812 TTAGAATTACTGTGAATTTATGG + Intergenic
1025243697 7:57299398-57299420 TTGAAATTGCAGTGAATATATGG + Intergenic
1025571474 7:62576556-62576578 TTGGGATCCCTTTGAGCATATGG - Intergenic
1027725414 7:81799335-81799357 TTGGAATACCTGTGTTTACAGGG + Intergenic
1027797091 7:82709358-82709380 TAGGAGTCCCTGGGAATACACGG - Intergenic
1027947963 7:84775119-84775141 TTGGAATCTGTGTCAAGATATGG + Intergenic
1030788435 7:113692732-113692754 TTGAATTCCCTGTGAATCTATGG + Intergenic
1031082665 7:117273638-117273660 CAGGAATCCATGTGAATATTGGG + Intergenic
1031721684 7:125184592-125184614 TTGGAATTGCTGTGCAAATAAGG + Intergenic
1034384676 7:150730299-150730321 TTAAACTGCCTGTGAATATATGG - Intronic
1035108320 7:156460249-156460271 CTGAAGTCCCTGTGAAAATAAGG + Intergenic
1035488287 7:159248466-159248488 TTTCAATCCCTTTGAATATATGG - Intergenic
1036386657 8:8287582-8287604 TTGGAACCCCAGTGCAAATAAGG - Intergenic
1038845844 8:31228962-31228984 GTGGAATCCCTGTCAATGAAAGG - Intergenic
1041478966 8:58296757-58296779 TTGGAATTGCATTGAATATATGG - Intergenic
1042670354 8:71256085-71256107 TTGGAATCCCTGTGCACAGCTGG + Intronic
1045494709 8:102698717-102698739 TTGGAAGGGCTGTGAATATTCGG - Intergenic
1047949646 8:129921431-129921453 TTTGAAACCATGTGAATATCTGG - Intronic
1049699697 8:144004614-144004636 CAGGAATCTCTGTGAACATAGGG - Intronic
1050370115 9:4912478-4912500 ATGGGATCACTGTGAATGTAGGG - Intergenic
1050412404 9:5380853-5380875 TTGTAATCCCTATGTATAGAGGG + Intronic
1052415902 9:28177042-28177064 TAGGAATCCCTGAAAATTTAGGG + Intronic
1052724277 9:32211139-32211161 TTGGAGACCCTGTGAAATTAGGG - Intergenic
1056299032 9:85222784-85222806 TTGGAACCCTTGTGATTACATGG + Intergenic
1059615496 9:115946558-115946580 TTGGAATCCCACTGGATATATGG - Intergenic
1059636040 9:116171623-116171645 TTGGAATCCCTGTGAACAGTGGG + Intronic
1061513284 9:131073689-131073711 TTTGCAACCCTGAGAATATAGGG - Intronic
1187258642 X:17664759-17664781 TTGGCATTCATTTGAATATATGG + Intronic
1187535357 X:20136975-20136997 TTGGAATACCTGAGGAAATATGG + Intronic
1188122165 X:26320567-26320589 TTTGAATCACTGTCAGTATAGGG - Intergenic
1189888241 X:45571760-45571782 TTGGAATCCTCCTGAATAAACGG - Intergenic
1193274960 X:79575270-79575292 TTGGAATCCCTGTGTAGAATCGG + Intergenic
1193688857 X:84614080-84614102 TTGGAAGCTCTGTGAAGCTAGGG - Intergenic
1196177885 X:112660369-112660391 TTTAAATCCCTCTGAAGATAGGG + Intronic
1196471098 X:116028632-116028654 TTGGAAGCTATGTGAATACATGG - Intergenic
1197024382 X:121730240-121730262 GTGGAATATCTGTGAATAAACGG + Intergenic
1198134842 X:133738661-133738683 CTGAAATCCCTGGGAATAGAGGG - Intronic
1199798501 X:151226900-151226922 TTGGAAATACAGTGAATATATGG - Intergenic
1201404726 Y:13638166-13638188 GTGGAATCCCTGTGGAAACAAGG - Intergenic
1201420454 Y:13793226-13793248 TTGGGATCCCTGGGAATCTTTGG + Intergenic
1201504202 Y:14679831-14679853 TTGGAACCCCTGGGAATCCATGG - Intronic