ID: 963743758

View in Genome Browser
Species Human (GRCh38)
Location 3:149105618-149105640
Sequence CAGTGCTGCAGTGGAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963743753_963743758 23 Left 963743753 3:149105572-149105594 CCAATCACTGAGACAACAATTAT No data
Right 963743758 3:149105618-149105640 CAGTGCTGCAGTGGAAGAGATGG No data
963743755_963743758 -2 Left 963743755 3:149105597-149105619 CCAAGGAAGAAAGTTTTCATCCA No data
Right 963743758 3:149105618-149105640 CAGTGCTGCAGTGGAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963743758 Original CRISPR CAGTGCTGCAGTGGAAGAGA TGG Intergenic
No off target data available for this crispr