ID: 963743758 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:149105618-149105640 |
| Sequence | CAGTGCTGCAGTGGAAGAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963743753_963743758 | 23 | Left | 963743753 | 3:149105572-149105594 | CCAATCACTGAGACAACAATTAT | No data | ||
| Right | 963743758 | 3:149105618-149105640 | CAGTGCTGCAGTGGAAGAGATGG | No data | ||||
| 963743755_963743758 | -2 | Left | 963743755 | 3:149105597-149105619 | CCAAGGAAGAAAGTTTTCATCCA | No data | ||
| Right | 963743758 | 3:149105618-149105640 | CAGTGCTGCAGTGGAAGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963743758 | Original CRISPR | CAGTGCTGCAGTGGAAGAGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||