ID: 963746588

View in Genome Browser
Species Human (GRCh38)
Location 3:149130187-149130209
Sequence GTTTTCTGCAGAAAGGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963746588 Original CRISPR GTTTTCTGCAGAAAGGCCTC TGG Intronic
900196995 1:1381475-1381497 GTTTTCTGCAGAATGGGCTCTGG + Intergenic
901154708 1:7127815-7127837 GTTGTCCTCAGAAAGCCCTCAGG + Intronic
902946580 1:19844957-19844979 CTCTTCTGCACAGAGGCCTCGGG + Intergenic
903056730 1:20641259-20641281 ACTTTCTCCAAAAAGGCCTCAGG - Intronic
904081251 1:27873706-27873728 GCTTTCTGCAGGAAGGCGCCTGG + Intronic
904722266 1:32519179-32519201 GTTTTCTGTAAAACAGCCTCAGG - Intronic
905402897 1:37716284-37716306 TGTTTCTGCAGAAGGGCCCCTGG - Exonic
907753762 1:57289195-57289217 GTATTCTGCAGAGAGGATTCAGG - Intronic
908203506 1:61821565-61821587 GTTGTCTGAAGGAAGGCCTGTGG + Intronic
909131297 1:71740551-71740573 GTGTTCAGCAGACAGGCCCCAGG - Intronic
909345763 1:74584517-74584539 GTCATCTGCAGAAAGACCACAGG - Intronic
910577922 1:88788251-88788273 GTGTTCTGCAGAATTGTCTCAGG + Intronic
912188486 1:107309684-107309706 GTTTTCTCTAGAAAGGATTCTGG + Intronic
912788642 1:112629072-112629094 CTTTTCTGCTCAAAGCCCTCCGG + Intronic
915698698 1:157770195-157770217 GATTCCTGCTGAAAAGCCTCTGG + Intronic
916091893 1:161314159-161314181 GATTTCGGCAGAAACGCCGCTGG - Intergenic
917231591 1:172843556-172843578 ATTGTCTGCAGAACGACCTCAGG + Intergenic
919721039 1:200836005-200836027 ATTTTCTACAGAAAGGGCTTTGG + Intronic
919935389 1:202247463-202247485 ACTTTCTGCAGAAAGTCCTTAGG - Intronic
921528498 1:216249259-216249281 GTTTCCTGCAGAAAACCATCTGG + Intronic
923763069 1:236865161-236865183 GTTTGTTGCAGGAAAGCCTCAGG - Intronic
924659768 1:246005613-246005635 GTTTTCTGCAGAGAGTCATATGG + Intronic
1062764454 10:50057-50079 ATCTCCTGCAGAAAGGCTTCCGG + Intronic
1063760286 10:9067119-9067141 GTTCTCTGTTGAAACGCCTCCGG + Intergenic
1063969475 10:11371454-11371476 GCTTTCTGAAGGAAAGCCTCAGG - Intergenic
1064107006 10:12508732-12508754 GTGAACTGCAGAGAGGCCTCAGG - Intronic
1064125716 10:12658486-12658508 GTTTTGTGCACATAGGCCTGGGG - Intronic
1070711155 10:78684082-78684104 TTTTTGTGCCCAAAGGCCTCAGG - Intergenic
1073765619 10:106679451-106679473 GTTTTCTGCAGACTTGCTTCAGG + Intronic
1075063124 10:119270656-119270678 GTCTTCTGCAGAGAGGGCTGTGG - Intronic
1075518980 10:123132827-123132849 GTGTTCTCCAGGAAGGACTCGGG - Intergenic
1075695975 10:124435667-124435689 GTTTTAAGCTGAAAGGCCACTGG + Intergenic
1077048921 11:558077-558099 GTCTTCTGCAGAAGGCCCCCAGG + Intronic
1077468906 11:2747684-2747706 GCTTCTTGCAGAAAGGCCACAGG + Intronic
1078087394 11:8242498-8242520 GTTTGCTACAGAAAAGCCCCAGG + Intronic
1080119814 11:28664396-28664418 GCTTTCTGCGGAGGGGCCTCAGG - Intergenic
1081181977 11:39995011-39995033 GTTTTATGCAAAAAGGACTTTGG + Intergenic
1082948372 11:58785293-58785315 GTTCTTTGAAGAAATGCCTCAGG + Intergenic
1083007731 11:59364105-59364127 TTTTTCTTCAAAAAGACCTCTGG - Intergenic
1085715606 11:78870609-78870631 GTTTTCTGGAGAATGGATTCTGG + Intronic
1089550159 11:119268825-119268847 GTTTGCTTCAGAAAGAGCTCTGG + Intronic
1090077226 11:123587109-123587131 GTCTTCTGCAGAGAGGCAGCAGG - Intronic
1090194020 11:124799956-124799978 GTGTTCGGCAGCAAGGCCCCCGG - Exonic
1095740566 12:45602290-45602312 TTTATATGCAGAAAGGACTCAGG - Intergenic
1096464465 12:51840762-51840784 GTTATCTGCAGGAACTCCTCAGG + Intergenic
1096529674 12:52234723-52234745 CCTTTCTCCAGCAAGGCCTCAGG - Intronic
1097502758 12:60426584-60426606 GTTTTCTCCAGAATTGCCTATGG + Intergenic
1097687409 12:62703769-62703791 GCTTTTTGCAGGAAGGTCTCAGG - Intronic
1097912551 12:64986078-64986100 GGTTTCTGTAGGGAGGCCTCAGG + Intergenic
1100793533 12:98156183-98156205 GTTTTCTGCAGAAAGCATTAGGG + Intergenic
1101249104 12:102914868-102914890 ATCTTCTCCAGAAATGCCTCTGG + Intronic
1104535400 12:129613794-129613816 GGGTTCTGCAGACAGTCCTCTGG - Intronic
1105046416 12:133007609-133007631 GTTGTCTTCAGAAATGCTTCTGG + Intronic
1105758320 13:23490338-23490360 GCTGTCTGCAGTAAGGCCACAGG - Intergenic
1109723307 13:66305017-66305039 GTCTTCTGCAGATGGGCCTTTGG - Exonic
1113533383 13:111045488-111045510 GTTTAAGGCAGAAAGGGCTCTGG + Intergenic
1113709204 13:112452916-112452938 TTTTTCTGCAGAACCGCATCTGG - Intergenic
1117933846 14:60878798-60878820 GTTCTTTGAAGAAAGGCTTCAGG + Intronic
1119853580 14:77883337-77883359 GTTTTCTGCTGAAAGGGCTGGGG + Intronic
1121067927 14:90986670-90986692 GGCTGCTGGAGAAAGGCCTCAGG + Intronic
1122663061 14:103310777-103310799 CTTTTCTGGGGGAAGGCCTCAGG + Intergenic
1124220414 15:27846082-27846104 GCTGTCTACAGAAAGGCCTGGGG - Intronic
1126526767 15:49664897-49664919 GTTTTCTGCACAAAGGCAGTTGG + Intergenic
1126633964 15:50764033-50764055 GTTTTCTGGTGAGAGGGCTCAGG + Intronic
1126696616 15:51331263-51331285 CCTCTCTGCAGGAAGGCCTCGGG - Intronic
1127670144 15:61187334-61187356 GAACTCTGCAGAAAGGCATCTGG - Intronic
1128472445 15:67966694-67966716 TATTTCTGCAAAAAGGCCTTTGG + Intergenic
1128756152 15:70185345-70185367 CTGTGCTGCAGAAAGACCTCAGG + Intergenic
1130826314 15:87549999-87550021 GATTTCTGCAGTACAGCCTCGGG - Intergenic
1131547796 15:93330454-93330476 CTTTTCTGCTGAAATGCCCCCGG + Intergenic
1132126494 15:99231293-99231315 GTTAACTGTAGAAAAGCCTCAGG + Intronic
1133821252 16:9238450-9238472 GGAATCTGCAGAAAGGCCTGGGG + Intergenic
1138853875 16:60663623-60663645 GTTTTCTTCAGAGAAGCCTTTGG - Intergenic
1139824517 16:69746418-69746440 GTGTTCTGTAGGGAGGCCTCTGG - Intronic
1141072676 16:80972444-80972466 GTTTTCTATAGAAAGGGCTTGGG - Exonic
1141190793 16:81823251-81823273 GATCTCTGCAGTCAGGCCTCTGG + Intronic
1141460651 16:84176843-84176865 GTCTTCTGCAGCCAGGCCTCTGG - Intronic
1142251062 16:88992347-88992369 GTTCTCTGCAGAAAGCACCCCGG + Intergenic
1142440194 16:90093188-90093210 ATCTCCTGCAGAAAGGCTTCGGG - Intergenic
1142484443 17:237462-237484 GATTCCTGCAGAGAGGCCTGAGG + Intronic
1143678032 17:8451448-8451470 ATTCTATGTAGAAAGGCCTCAGG - Intronic
1143772684 17:9178687-9178709 GTCGTCTGCAGTAAGGCGTCCGG - Intronic
1144326680 17:14189090-14189112 TTTTTTTGAAGAAATGCCTCAGG + Intronic
1144353052 17:14417204-14417226 GGGTTCTGTAGCAAGGCCTCAGG - Intergenic
1144475558 17:15585953-15585975 TTTTTTTGAAGAAATGCCTCAGG + Intronic
1145969603 17:28949416-28949438 AGCTTCTGCAGAAAGGACTCTGG + Intronic
1145977306 17:28991735-28991757 GAGTTTTTCAGAAAGGCCTCGGG + Intronic
1146911047 17:36648773-36648795 GCATTGTGAAGAAAGGCCTCTGG - Intergenic
1148814806 17:50319916-50319938 GTTCTCTGCAGCAGGACCTCTGG - Intergenic
1148899097 17:50862176-50862198 GTTTTCTGAAGATCGACCTCTGG - Intergenic
1149131023 17:53302704-53302726 ATTTTCTGCAGATAGACTTCTGG - Intergenic
1150791021 17:68200196-68200218 GTTTGTTTCAGAAAGGCGTCCGG + Intergenic
1152650099 17:81488614-81488636 GGGCTCTGCACAAAGGCCTCAGG + Intergenic
1152772657 17:82179691-82179713 GTTTTCTGGAGGAAGCCCCCGGG - Intronic
1153923226 18:9809563-9809585 GTGTTCTGCAGAAGACCCTCAGG + Intronic
1153968311 18:10201909-10201931 GCCTTATGCAGAAAGACCTCTGG - Intergenic
1154012459 18:10587604-10587626 GTCTTCTCCAGAAAGACCACTGG - Intergenic
1155576821 18:27256992-27257014 AATTTCTGCAGAACGGCATCTGG + Intergenic
1155964384 18:32022025-32022047 CTCTACTGCAGAAAGGACTCTGG - Intronic
1156249750 18:35341510-35341532 GTTAACTGCAAAATGGCCTCAGG + Intronic
1156982187 18:43303007-43303029 GGTTTCTACAGTATGGCCTCAGG - Intergenic
1158509652 18:58079309-58079331 GCTTTCTGGAAAAAGGCTTCTGG + Intronic
1160043227 18:75364291-75364313 GTTTTCAGTGGAAAGGGCTCTGG + Intergenic
1160747312 19:718286-718308 GACGTCTGCAGAAAGGCCTTGGG + Intronic
1162753287 19:12841600-12841622 GTTTTCTGGAGAAACGTTTCTGG + Intronic
1164515573 19:28932518-28932540 GTCTTAGGCAGTAAGGCCTCTGG - Intergenic
1167111848 19:47467116-47467138 TTTTACTGCTGATAGGCCTCTGG - Intronic
1168614947 19:57830110-57830132 TTTTCCTGCAGAACCGCCTCTGG + Intronic
1168622314 19:57889199-57889221 TTTTCCTGCAGAAGCGCCTCTGG - Intronic
926446554 2:12949347-12949369 GTTTGTGGCAGAAAGGGCTCTGG + Intergenic
927016740 2:18971228-18971250 TTCTTCTGCAGAACAGCCTCAGG - Intergenic
928302135 2:30134867-30134889 GAATTCTGCAGAAAGACTTCAGG - Intergenic
928366510 2:30707015-30707037 GTTTCCTGCAGAAGGTCCTAAGG + Intergenic
931660785 2:64560535-64560557 ATTTTATGGAGAAAGGGCTCAGG - Intronic
932869636 2:75385253-75385275 GTGTTCTGCAGCACAGCCTCAGG + Intergenic
933698272 2:85236403-85236425 TTTGTCTGCAGAGAGGCCTCTGG + Intronic
934222881 2:90101782-90101804 GTTTACTGAAAAAAGGACTCAGG + Intergenic
935616125 2:105083653-105083675 GTATTCTGCAGAAAGCACTTTGG - Intronic
935794263 2:106625957-106625979 GTTTTCTCCAGATTGGCCTGAGG + Intergenic
936723642 2:115285498-115285520 GTTCTATGCAGAAAGGTCACCGG - Intronic
940300211 2:152169062-152169084 TTTTTCTTAAGAAAGGCTTCAGG - Intronic
940859127 2:158754137-158754159 TTTTTCTGCAGCAAAGCCCCAGG + Intergenic
942318647 2:174716987-174717009 GCTTCCTGCAGCAAAGCCTCAGG - Intergenic
942641212 2:178062503-178062525 CTTTTCTGAATAAAGTCCTCTGG - Intronic
942765752 2:179454522-179454544 GTTATCTGTAAAATGGCCTCAGG + Intronic
942980863 2:182079805-182079827 GTGTTCTTCAGCAAGTCCTCAGG + Intronic
943117835 2:183695119-183695141 GTTTCCAGCTGAAAGGCCTTTGG - Intergenic
944345387 2:198659283-198659305 ATCTTCTGCCAAAAGGCCTCTGG - Intergenic
948374980 2:237515457-237515479 GTTTCCTGCAGAGGGGCCCCAGG + Intronic
948901343 2:240958259-240958281 GTATCCTGCAGCCAGGCCTCAGG + Intronic
1169254168 20:4084583-4084605 ATTCTCTGAAGAAGGGCCTCTGG - Intergenic
1169988276 20:11471234-11471256 TTTTACTGCAGAAAAGACTCAGG + Intergenic
1170302602 20:14902470-14902492 GTTTTCTGAAAGAATGCCTCAGG - Intronic
1172774691 20:37400174-37400196 GCCTCCTGCAGGAAGGCCTCTGG - Exonic
1173002588 20:39115229-39115251 GATTTCTGCAGAAACGCCTCTGG - Intergenic
1173225523 20:41160304-41160326 GCTTTCTGCACAAAGTCCTCTGG + Intronic
1173345260 20:42193316-42193338 GTTTTCTGAACAGAGGCCTGGGG - Intronic
1174173971 20:48633554-48633576 GCTTTCAGCATACAGGCCTCTGG + Intronic
1174544312 20:51314013-51314035 GTTCTCTGCAGACAGAGCTCCGG - Intergenic
1175067636 20:56303239-56303261 ATTTTCTCCAGAAATGCCACAGG + Intergenic
1177026681 21:15929302-15929324 TATTTCTGCAGAAATGCCTAAGG - Intergenic
1178041099 21:28641949-28641971 GTCTACTGCAAATAGGCCTCTGG + Intergenic
1179266562 21:39808528-39808550 GTCTTATACAGAAAAGCCTCAGG - Intergenic
1180590233 22:16930918-16930940 GATGTCTGCAGAGAGGCCTCTGG + Intergenic
1182526822 22:30925809-30925831 GCTTCCTGCAGAGATGCCTCTGG + Intronic
1183370178 22:37427640-37427662 GCTTGCTGCGGAAAGGCCTGCGG - Intergenic
1183771826 22:39933247-39933269 GCTCACTGCATAAAGGCCTCAGG - Intronic
1184829449 22:46974956-46974978 GATTTCTGTAGAAAAGCCACAGG + Intronic
1185015141 22:48338622-48338644 GTCTTCTGCAGAACAACCTCAGG + Intergenic
1185260548 22:49859557-49859579 TTTTAGTGCAGAAAGGCATCTGG + Intronic
949935350 3:9111629-9111651 GTTTTCTGCAGCCTGGCGTCTGG - Intronic
952007339 3:28857139-28857161 GTTTTGTGCAGAAAGGGAGCTGG + Intergenic
952510846 3:34053348-34053370 GTTTTCTGCAGGGATGCCTGTGG + Intergenic
953059846 3:39418232-39418254 GTTTTCAACAGAAAGTCCTAAGG - Intergenic
953435241 3:42872645-42872667 GCTTTTGGCAAAAAGGCCTCTGG + Exonic
954656883 3:52199284-52199306 GCTTTCTGCAGAAAGGCCTGGGG - Exonic
955088702 3:55728577-55728599 GTTTTCAGCAGTAAGGACTGGGG + Intronic
955399551 3:58581619-58581641 ATGCTCTGCAGAAAGGACTCGGG + Intronic
955765133 3:62335836-62335858 ATTTTCTGCAGAAACACTTCTGG + Exonic
956665193 3:71635740-71635762 GTATTTTTCAGAAATGCCTCTGG + Intergenic
957562698 3:81843826-81843848 GTTTTAGGCAGAGAGACCTCTGG + Intergenic
958094841 3:88930714-88930736 TTTTTCTGGAGACAGGGCTCAGG + Intergenic
962251755 3:133840135-133840157 GTTCTCTTCAGAAACCCCTCTGG - Intronic
963746588 3:149130187-149130209 GTTTTCTGCAGAAAGGCCTCTGG + Intronic
968152770 3:196351758-196351780 GTTATATGCAGAAAGGGCACTGG - Exonic
969819753 4:9710839-9710861 GGGTGCTGAAGAAAGGCCTCAGG + Intergenic
970573342 4:17404147-17404169 CTTTTCTGCAGACAGGTTTCTGG - Intergenic
971065468 4:23027103-23027125 GTTTTCTGCACAAAGGCACATGG - Intergenic
974816201 4:67006975-67006997 GTATTCTGAAGAATGACCTCTGG + Intergenic
983171184 4:164538382-164538404 GTTTACAGCAGAAAAGCCTCTGG - Intergenic
987946616 5:24617775-24617797 CTCTTCTGCAGGGAGGCCTCTGG - Intronic
988436371 5:31179754-31179776 GTTTTCTGCAAAGAGAACTCAGG - Intergenic
989847272 5:46160476-46160498 ATTTTCTGCAGAGAGACCTCTGG + Intergenic
992672806 5:79076462-79076484 TTTTGATACAGAAAGGCCTCAGG - Intronic
993617142 5:90126975-90126997 ATTTACTGCAGAGATGCCTCAGG - Intergenic
995054357 5:107742972-107742994 TTTTTCATGAGAAAGGCCTCTGG - Intergenic
995231862 5:109774027-109774049 GTATTCTGCAGAATGTCCTTTGG - Intronic
995557353 5:113343459-113343481 GTTATCTGCCTAAATGCCTCAGG + Intronic
995857248 5:116606334-116606356 CTTTTCTGTAGAAAGGCATGAGG + Intergenic
996760172 5:126978893-126978915 ATTTTCTGGAGCAAGGGCTCTGG + Intronic
997764585 5:136487668-136487690 TTTTAATGCAGAAAGTCCTCTGG + Intergenic
998507038 5:142680316-142680338 GTCTTCTGAAGAAAGGACACAGG + Intronic
1001246547 5:170109254-170109276 GTTTCCTGCACTAAGGCCACTGG - Exonic
1001246783 5:170110944-170110966 CTTTTCTGCAGAGAGACTTCTGG + Intergenic
1001648093 5:173297112-173297134 GTTTGCTGCAGGACAGCCTCTGG - Intergenic
1001934033 5:175692010-175692032 GTTTTCTGCACAAAAGCATCAGG - Intergenic
1002292435 5:178209132-178209154 GTTCTCTGCTGGAAGGCCTTTGG + Intronic
1003894258 6:10591882-10591904 GTTCTCTGCAGGAAGGTCACTGG + Intronic
1004447413 6:15712916-15712938 ATTATTTGCAGAAATGCCTCCGG - Intergenic
1004493086 6:16136202-16136224 GTTGACTGCAGAAGGGCTTCAGG - Intronic
1005400266 6:25424880-25424902 GGCTTATGCAGAAAGGCCACTGG + Intronic
1010704966 6:79096837-79096859 CTTATCTGCAGAAAGGCTTGTGG + Intergenic
1014036997 6:116778207-116778229 GTTTCCTGGAGCAAAGCCTCAGG - Intergenic
1014524137 6:122481202-122481224 GTTTTTGGCAAAAATGCCTCAGG - Intronic
1019519778 7:1455386-1455408 GTTCTCTGCAGCCAGGCCTCAGG - Intronic
1023253425 7:38289944-38289966 GATTTCTTCAGGATGGCCTCAGG + Intergenic
1023860540 7:44215551-44215573 GGCATCTGCAGAAGGGCCTCAGG + Intergenic
1025635191 7:63315201-63315223 GGTCTCGGCAGAAAGGCCTGGGG - Intergenic
1025647504 7:63432969-63432991 GGTCTCGGCAGAAAGGCCTGGGG + Intergenic
1028821793 7:95220185-95220207 TGTTTTTGCCGAAAGGCCTCTGG + Intronic
1030424733 7:109360536-109360558 GTTTTCTTCATAAAACCCTCCGG + Intergenic
1032303949 7:130715053-130715075 GTTTTCTACAGGGAGGCATCAGG + Intergenic
1032940794 7:136788307-136788329 GACTTCTTCTGAAAGGCCTCTGG - Intergenic
1033270491 7:139928871-139928893 GTTATCTGCACAAAGCCCTTGGG + Intronic
1033341426 7:140495237-140495259 GCTTTATAAAGAAAGGCCTCAGG + Intergenic
1033556502 7:142492575-142492597 GTTCTCTGCAGAGAGGCCTGAGG + Intergenic
1033558868 7:142512029-142512051 GTTCTCTGCAGAGAGGCCTGAGG + Intergenic
1033560935 7:142529664-142529686 GTTCTCTGCAGAGAGGCCTAAGG + Intergenic
1035359395 7:158300389-158300411 TTTTTCTGCACACAGGCCCCTGG - Intronic
1037968319 8:23151198-23151220 GTTTTCTGCTGAGAAGCCTTTGG - Intronic
1038197818 8:25384279-25384301 GTTGGCTGCAGAAGGGCCTGGGG + Intronic
1040424184 8:47268354-47268376 AATTTCTGCAGAAAGCCATCTGG + Intronic
1041506093 8:58599339-58599361 CTCTTCTGGAGAAAGTCCTCGGG + Exonic
1043203244 8:77400398-77400420 GTTATCTGAAGTAAGGCATCTGG - Intergenic
1048171566 8:132111522-132111544 GTCTTCTGAAGAAAGGGCTGGGG + Intergenic
1048473749 8:134724999-134725021 GTTTTCTCAAGCAAGGCCCCAGG - Intergenic
1048872633 8:138812051-138812073 GCTTTCTGCCCCAAGGCCTCAGG - Intronic
1053752576 9:41271982-41272004 TCTTTCTGCAGAAATGCCTTTGG - Intergenic
1054258104 9:62836334-62836356 TCTTTCTGCAGAAATGCCTTTGG - Intergenic
1055838568 9:80475025-80475047 TATTTCTCCAGAAATGCCTCAGG + Intergenic
1058338667 9:103865460-103865482 GTCTGCTGCAGAAAGTCTTCTGG + Intergenic
1058569258 9:106323198-106323220 GTTTTATGCAAAAAGGCATTTGG + Intergenic
1058582981 9:106479086-106479108 GTTTGCTTTACAAAGGCCTCAGG + Intergenic
1059059393 9:111019499-111019521 GTTTTCTGCTGAACGGCTACTGG + Intronic
1059649094 9:116298164-116298186 GTGTCCTGCAGACATGCCTCAGG + Intronic
1059973401 9:119690816-119690838 GTTTTCTGAAGAAAGCCATTTGG - Intergenic
1061648970 9:132030751-132030773 GTGTTCAACAGGAAGGCCTCTGG - Intronic
1062740788 9:138174200-138174222 ATCTCCTGCAGAAAGGCTTCGGG - Intergenic
1202800676 9_KI270719v1_random:172042-172064 TCTTTCTGCAGAAATGCCTTTGG + Intergenic
1186179477 X:6959157-6959179 TTGTTCTGCTGAATGGCCTCTGG - Intergenic
1186564427 X:10646871-10646893 TTTTTCTGCAAAATGGCCTGTGG - Intronic
1186745377 X:12562691-12562713 GTTTTCAGTAGAAAGCGCTCTGG - Intronic
1186852907 X:13597833-13597855 GTTTTCTGCTGTAAAACCTCTGG - Intronic
1188283169 X:28295857-28295879 TTTTTATTCAGAAAGGCCTGGGG - Intergenic
1192206567 X:69100537-69100559 CTTCTCTGCAGGAAGCCCTCAGG + Intergenic
1193525950 X:82589501-82589523 TTTTTCTGCAGAAAAGGCTATGG - Intergenic
1195680621 X:107543412-107543434 GTTATCTGGAGAAAGGCTTCTGG - Intronic
1196948423 X:120851162-120851184 TTTCTCAGCAGAAAGGCTTCAGG - Intergenic
1201277684 Y:12313967-12313989 CTTGTATGCAGAAAAGCCTCAGG + Intergenic
1201357573 Y:13113274-13113296 CTTGTATGCAGAAAAGCCTCAGG + Intergenic