ID: 963746946

View in Genome Browser
Species Human (GRCh38)
Location 3:149134138-149134160
Sequence CAGGGGCCTGCACTGGGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 515}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963746942_963746946 -6 Left 963746942 3:149134121-149134143 CCTAATGACAACATTAGCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 93
Right 963746946 3:149134138-149134160 CAGGGGCCTGCACTGGGCCACGG 0: 1
1: 0
2: 2
3: 42
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963746946 Original CRISPR CAGGGGCCTGCACTGGGCCA CGG Intronic
900023400 1:200269-200291 CAGGGGCGGGCCCTGGGCCTGGG - Intergenic
900204646 1:1426800-1426822 CTGTGGCCTGCTCTGGGCCCCGG + Intronic
900205985 1:1432108-1432130 CAGGGGCCTGGACTGGGATAGGG - Intergenic
900350729 1:2233282-2233304 CAGGGTCCTGTTCTGGGCCGGGG + Intronic
900387318 1:2416562-2416584 CAGCGGGCGGCACTGGGCCCAGG + Intergenic
900556927 1:3285244-3285266 CAGGGGCCTCCACGGGGCTGGGG - Intronic
900597755 1:3490262-3490284 CAGGGGCACGCTCTGGGCCTGGG - Exonic
900618445 1:3576125-3576147 CCGAGGCCTGCACTGGGCCGGGG + Intronic
900690431 1:3977474-3977496 GAGGGGCCTGGACTGGCCCCTGG + Intergenic
900793009 1:4691921-4691943 CAGGGACCTGCAGAGGGACAAGG + Intronic
900991540 1:6100451-6100473 CAGGGTCCTGCAGTGGCCAATGG + Exonic
901789460 1:11646767-11646789 CCGGAGCCTGCACTGGGCTATGG - Intergenic
902227847 1:15007941-15007963 CAGGGGCCGCCTCTGTGCCAAGG - Intronic
902290684 1:15432705-15432727 CAGGGTCCAGCAATGGGGCAGGG + Intergenic
902311589 1:15585200-15585222 CACTGGCCGGCACTGTGCCAGGG + Intronic
902554842 1:17240820-17240842 CACCAGCCTGCCCTGGGCCAGGG - Intronic
902896725 1:19484988-19485010 CAGCGGCCTAGCCTGGGCCATGG + Intronic
903013604 1:20347823-20347845 CAGGGGCCTGCCCTGTGGGAGGG + Intronic
903223384 1:21881212-21881234 CAGGGGGCTGCATCGGGGCATGG + Intronic
903832236 1:26182318-26182340 CAGGGGCCTCCCCTGAGCAAGGG - Intronic
903867345 1:26409502-26409524 CAGGGCCGTGCACTGAGCCCCGG + Intergenic
904038041 1:27569108-27569130 CAGGGCTGTGCACTGGGCGATGG - Intronic
904317502 1:29675202-29675224 CAGGGTCCTGCACATGGCCTGGG + Intergenic
905773010 1:40650257-40650279 CATGGGCCTTCACTGGGCTGGGG + Intronic
906207092 1:43992556-43992578 CAGGGTCCTGCACTTTGCCTTGG + Exonic
906291518 1:44622520-44622542 CAGGGGCCAGCACTAGCCCTTGG + Intronic
906674953 1:47686932-47686954 CAGGGGCCAGGACTGGGACTAGG - Intergenic
906747120 1:48229892-48229914 AAGGAGCCTGGACTGGGTCATGG - Intronic
906820169 1:48920941-48920963 CAAGGCCCTGTACTGGGACAAGG + Intronic
907401495 1:54227482-54227504 TGGAGGCCTGCACTGGGCAAGGG - Intronic
907826921 1:58026867-58026889 CAGGTGCCTGCACCTGTCCAGGG + Intronic
908622252 1:65997124-65997146 CAGGGGGGTGCAGTGGGCCCAGG - Intronic
909501233 1:76337635-76337657 CATAGGTCTGGACTGGGCCAGGG - Intronic
911061729 1:93753971-93753993 CAGGTGCCTGGACTGTGACATGG + Intronic
911702273 1:100967455-100967477 CACGGGCCAGTACTGGTCCATGG - Intronic
912547774 1:110463477-110463499 CTGGGGCCTGCACACAGCCATGG + Intergenic
912698879 1:111861530-111861552 CAAGGTCCTGCAGTGGGCCTGGG - Intronic
913206674 1:116545361-116545383 CAGGGGCCAGCACAGAGGCAGGG + Intronic
913398144 1:118395749-118395771 CAGGGGCCTTCACTCAGGCATGG - Intergenic
915005442 1:152630680-152630702 CTGGGGCCTGCCCTGGGCTGGGG + Intergenic
915368137 1:155326734-155326756 CAGGGGCCTGAGGTGGGCCCAGG - Exonic
915466588 1:156102052-156102074 GAGGGCCTGGCACTGGGCCAAGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919753367 1:201052126-201052148 CAGGGGCCTATGCTTGGCCAGGG - Intronic
919790248 1:201285860-201285882 CAGGGGGCTTCACTGGGGGAGGG + Intronic
920298822 1:204976070-204976092 CAGGGCCCTGCAGTTGGACACGG + Intronic
920826924 1:209431171-209431193 ATGGGGCTTGCACTGAGCCATGG + Intergenic
920835320 1:209505617-209505639 CTGAGGCCTCCACTGGACCAAGG - Intergenic
920840764 1:209551775-209551797 CAGGAGGCAGCACTGGGACAGGG - Intergenic
920847991 1:209609535-209609557 CAGGGGCCAGCGCTGGCACATGG - Intronic
924422863 1:243925402-243925424 CTGGGCCCTGCACTGGGGAAGGG + Intergenic
924792989 1:247270082-247270104 CAGTGGCCTGAACTGTGCCTGGG + Intergenic
1062760534 10:13449-13471 CAGGGGCCAGCCATGGGACAAGG + Intergenic
1062956618 10:1544393-1544415 GAGAAGCCTGCCCTGGGCCAAGG - Intronic
1063200594 10:3782860-3782882 CAAGGGCCTGCACTTGGGAACGG - Intronic
1063842431 10:10087961-10087983 CACGGGCCAGTACTGGTCCATGG + Intergenic
1064093315 10:12403888-12403910 CAGGGACCTGCTCTGTGACATGG - Intronic
1064130933 10:12709005-12709027 CTGGGGCCTGAACTGTGGCATGG + Intronic
1066010334 10:31188551-31188573 CAAGTGCCTGCCCTGGGCCAGGG + Intergenic
1066223163 10:33355880-33355902 CAGGAGGCTGCAGTGAGCCAAGG - Intergenic
1066365862 10:34776451-34776473 CAGGGGCCAGCACATGGCCAGGG + Intronic
1067088476 10:43254922-43254944 GAGGGGCCTCCAGTGGGCCCTGG - Intronic
1067878823 10:50026304-50026326 TAGAGGCCTGCATGGGGCCATGG - Intergenic
1067892917 10:50151638-50151660 TAGAGGCCTGCATGGGGCCATGG + Intergenic
1069892503 10:71661130-71661152 GAGGGGGCTGCACTGCCCCATGG - Intronic
1070542288 10:77424987-77425009 CAGGGCCTAGCACTGGGCCTGGG + Intronic
1070682144 10:78456144-78456166 CAGAGGCCTGCGGTGGCCCAGGG + Intergenic
1070695769 10:78561928-78561950 CAAGGCTCGGCACTGGGCCAGGG + Intergenic
1071599901 10:86953988-86954010 CAGCAGCCTGTACTGTGCCAAGG - Intronic
1073111320 10:101064602-101064624 CAGGGGCCTCCACTTGACCCAGG - Exonic
1074416686 10:113273176-113273198 CAGAGGCCTGGACTGGGGCTGGG - Intergenic
1074859506 10:117499648-117499670 CAGGGGCCTGGGCTGGGAGATGG + Intergenic
1075086593 10:119418121-119418143 CCTGGGGCCGCACTGGGCCAGGG - Intronic
1075848272 10:125564791-125564813 CAAGGACCTGTACTGGTCCATGG + Intergenic
1076231622 10:128824160-128824182 CAGTGGCCTTCACTGGCCCTCGG + Intergenic
1076581555 10:131515636-131515658 CAGGGGCCTGCACCTGACTACGG - Intergenic
1076591652 10:131587619-131587641 CTGGGTCCTGCCCTGGGCCTTGG - Intergenic
1076731040 10:132439030-132439052 GAGAGGCCTGCACTGGGCACTGG - Intergenic
1076773902 10:132682519-132682541 TAGAGGCTGGCACTGGGCCATGG + Intronic
1076882834 10:133247952-133247974 CAGAGGGCTGCTCTGTGCCAAGG + Intergenic
1077239863 11:1504863-1504885 AAGGGGACCGCACTGGGGCACGG + Intergenic
1077300110 11:1842857-1842879 CAGGGGACTGCACACAGCCAAGG - Intergenic
1077343269 11:2035450-2035472 CAGGGGGCTGGCCGGGGCCAGGG - Intergenic
1077393960 11:2312178-2312200 CAGGCGCCTGCCATGGCCCAAGG - Intronic
1077913729 11:6597154-6597176 TAGGAGCCTGCACTGGGAAAGGG + Exonic
1078085428 11:8230709-8230731 GAGGGACCTTCACAGGGCCAGGG - Intronic
1078929230 11:15900814-15900836 GAGGGGCCTCAACTTGGCCATGG + Intergenic
1080560492 11:33458180-33458202 GTGGGGCCAGCACAGGGCCAGGG + Intergenic
1081989304 11:47329172-47329194 CAGGGGCGTGCCCTGGGCTGGGG - Exonic
1082106956 11:48230824-48230846 CAGGGGCCTGTAGTGGGGTAGGG - Intergenic
1083150204 11:60787119-60787141 CAGCGCTCTGCACAGGGCCACGG - Intronic
1083367055 11:62147727-62147749 CAGGGGGCTGCACTGAGTCAGGG + Intronic
1083684522 11:64368504-64368526 CGGGAGCCTGCGCTGGGCCAGGG + Exonic
1083795341 11:65013797-65013819 CGGGGGCCTACACTGGCCCCAGG + Intergenic
1084192500 11:67505303-67505325 CATGGGCCGGCACTGCGCCTCGG - Exonic
1084288407 11:68146506-68146528 GAGGGGTCTGGACTGGCCCAGGG + Intergenic
1084396175 11:68911937-68911959 CAGGGGCCTGGAGTTGGCCTGGG + Intronic
1084760525 11:71267900-71267922 CAGGGGCCTGCCCTGGGTGGTGG - Intergenic
1085769229 11:79310122-79310144 CCGGGGCCTGTGCTGGGCCCTGG - Intronic
1087428447 11:98019600-98019622 CATGGACCAGCACTGGTCCATGG + Intergenic
1087672079 11:101119215-101119237 CATGGGCCCGCACCGGACCATGG + Intronic
1088621153 11:111685319-111685341 CACGGACCAGCACTGGTCCATGG - Intronic
1088749551 11:112832169-112832191 CACAGGCCTGAACTGGCCCAAGG + Intergenic
1088816461 11:113424306-113424328 CAGGGCCCTGCACTGGACACTGG - Intronic
1089619089 11:119712338-119712360 CGGGGGCCTGAACTGGGGGAGGG - Intronic
1090389705 11:126381099-126381121 CAGAGGCCAGCTCTGGGCTAGGG - Intronic
1202826255 11_KI270721v1_random:90639-90661 CAGGGGGCTGGCCGGGGCCAGGG - Intergenic
1091377099 12:31807-31829 CAGGGGCGGGCCCTGGGCCTGGG - Intergenic
1091630247 12:2154504-2154526 CCGGGGCCAGCAGTGGGTCAGGG + Intronic
1091776352 12:3187442-3187464 CAGGGCCCAGCACTGGACCCAGG + Intronic
1091850913 12:3696240-3696262 CCGGGCCCTGCACTAGGCAATGG + Intronic
1092162239 12:6322071-6322093 CTGGGGCCAGCACTGGGCACAGG + Intronic
1093400544 12:18741070-18741092 CAATGGCCTTCACTGGGCTATGG - Intergenic
1096205392 12:49717345-49717367 CAGGGGCAGGTACTGGGCAAGGG - Intronic
1096654305 12:53079146-53079168 CCAGGCCCTGCACTGGGCCGAGG + Intronic
1096995118 12:55833491-55833513 CACGAGCTTCCACTGGGCCAGGG - Intergenic
1097191020 12:57219703-57219725 CAGGGGCCGCAGCTGGGCCAGGG + Intronic
1097955828 12:65484324-65484346 CAGGGTCCTGCACCTGGCCCAGG + Intronic
1098230760 12:68370028-68370050 CAAGGGCCCGGACTGGGCAAAGG + Intergenic
1101351155 12:103930656-103930678 CCGGGGCCTGCGGTGGGCCAAGG + Intronic
1101820483 12:108180438-108180460 CACGGGCCTGGCCTGAGCCAAGG - Intronic
1102010984 12:109618129-109618151 CAGGCGGCTGACCTGGGCCAGGG - Intergenic
1102017423 12:109657017-109657039 CAGAGGCGTGCACTGGGCTGGGG - Intergenic
1102124713 12:110470432-110470454 CAGGATCCTGCAGTCGGCCAAGG - Intronic
1102466916 12:113135442-113135464 CAGGGAGCTGCTCTTGGCCATGG + Exonic
1102976383 12:117209795-117209817 CAGGGACTGGCAGTGGGCCAAGG + Exonic
1103034746 12:117647441-117647463 CAGGAGCCAGCACGGGCCCAGGG + Intronic
1103138243 12:118526466-118526488 CAGGTCCCTGTGCTGGGCCAAGG + Intergenic
1103400705 12:120641101-120641123 CCGGGGCCTGCAGTGCGCCTGGG - Exonic
1104620358 12:130307436-130307458 CAGGGCCCTACTCTGTGCCATGG + Intergenic
1105546082 13:21352067-21352089 CAGCAGCCTGCTCTGGGGCAGGG + Intergenic
1107035430 13:35897330-35897352 CAGGGGCCTGTGCTGTGCTAGGG + Intronic
1107836138 13:44413803-44413825 CCGAGGCCTGCCCTGCGCCAAGG - Intergenic
1108523609 13:51266177-51266199 CAGTGGCCTCCACTGGGGAAAGG - Intronic
1110460936 13:75745115-75745137 CAGGAGCCTGGAGTGGGCCCTGG + Intronic
1112452244 13:99523200-99523222 CTGTGGCCTGGGCTGGGCCACGG + Intronic
1113071583 13:106426619-106426641 AAAGGGCCTGCCCTGTGCCAGGG - Intergenic
1113440781 13:110326519-110326541 CTGGGGCCTGCAATGTGCTAAGG - Intronic
1113451501 13:110413400-110413422 CAGTGCCCTGCAGTGTGCCATGG + Intronic
1113933803 13:113982526-113982548 CAGGGCCCTGCCCTGGCTCAAGG - Intronic
1114504195 14:23196462-23196484 CAGGGGCCTGCTCTGTCACACGG + Intronic
1117690131 14:58298166-58298188 CAGGGGCTTGCACGGGGGCGGGG - Intergenic
1117766914 14:59093023-59093045 CAAGGCCCCCCACTGGGCCAGGG + Intergenic
1119122222 14:72090281-72090303 CAGGGACCGGTACTGGTCCATGG - Intronic
1119296518 14:73537652-73537674 CATGGGGCTGCTCTGGGCCTTGG + Exonic
1119300763 14:73569657-73569679 CATGGGGCTGCTCTGGGCCTTGG + Exonic
1119303979 14:73592190-73592212 CATGGGGCTGCTCTGGGCCCTGG + Exonic
1119481321 14:74960071-74960093 CAGTGGGCAGCTCTGGGCCAAGG + Intergenic
1119542940 14:75452542-75452564 CTGTGGGCTGCACTGGCCCACGG - Intronic
1119546775 14:75477745-75477767 TAGTGGCCTGCAGTGGGGCAGGG + Intergenic
1120985542 14:90331649-90331671 CAGAGGCCTGTTCTGGACCAAGG - Intronic
1121107763 14:91292289-91292311 CTGGGGCCTGCTCCGGGCCCTGG - Intronic
1121214921 14:92240321-92240343 CATGGTCCTTCACTGGGCCCGGG + Intergenic
1121653434 14:95576700-95576722 CAAGGGCCTGGCCTGGGCAAGGG + Intergenic
1121825613 14:97007663-97007685 CTGGGGGCTGCTCTGGGCCTGGG - Intergenic
1122117081 14:99533156-99533178 CAGGGGCCTCCACTGCAGCATGG + Intronic
1122364276 14:101185309-101185331 CAGGGGGGAGGACTGGGCCATGG - Intergenic
1122421208 14:101578695-101578717 CAGGGTGGTGCACGGGGCCAAGG + Intergenic
1122651833 14:103230667-103230689 CAGGGGCTGGCTCTGGGCTATGG - Intergenic
1122676981 14:103423647-103423669 CAGGCTCCAGCTCTGGGCCAAGG + Intronic
1122814763 14:104306991-104307013 CAGGGGCCTGTCCTGGCCCTGGG + Intergenic
1122960560 14:105092030-105092052 CAGAGACCAGCACTGGGCAATGG + Intergenic
1124399608 15:29336774-29336796 CAGGAGCCAGCTGTGGGCCAGGG - Intronic
1127902771 15:63353457-63353479 CTGGGTCCTGCCCTGTGCCAAGG + Intronic
1128728222 15:70003460-70003482 GAGGGGCCTGCATTTGGCAAGGG - Intergenic
1128944453 15:71811452-71811474 CAGGGGGCAGGGCTGGGCCAGGG - Intronic
1129226684 15:74174407-74174429 AAGGGGCCTCGTCTGGGCCAAGG + Intronic
1129274979 15:74439211-74439233 CAGAGGCCTGGACTGGGTCAGGG - Intergenic
1129708435 15:77807933-77807955 GAGGGGCCTGGAAGGGGCCAAGG + Intronic
1130276171 15:82477405-82477427 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130468530 15:84204798-84204820 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130495734 15:84468744-84468766 CCGGGCCCTGCAGGGGGCCATGG + Intergenic
1130590823 15:85209397-85209419 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1131188541 15:90294816-90294838 CCGGGCCCTGCAGGGGGCCAAGG + Intronic
1132115333 15:99131645-99131667 CAGTGGCCGACACTGGGCCCTGG - Exonic
1132905114 16:2278514-2278536 CACGGGCCTCCACTGGGACATGG - Intronic
1132929423 16:2451320-2451342 CACTGGTCTGCACTGGGCCCTGG - Intronic
1132938329 16:2493759-2493781 CAGGTGGCTGCCCTGGCCCAAGG - Intronic
1132983173 16:2749603-2749625 CAGGGTCCTCCACCAGGCCATGG + Intergenic
1133040548 16:3058165-3058187 CAGGGGCCTGCAGGGGACAAAGG - Exonic
1133130301 16:3672646-3672668 CAGCGGGCGACACTGGGCCACGG + Intronic
1133315387 16:4880395-4880417 CTGGGGCTTGCGCTGGGCCGTGG + Exonic
1134875760 16:17697334-17697356 CTGGGGCCTGCCGTGGGGCAGGG - Intergenic
1136011155 16:27364067-27364089 CAGGGGCCTGCCGTGGGGCACGG - Exonic
1136093571 16:27937786-27937808 CAGGGGACTGTCCTGGGCCCAGG + Intronic
1136275903 16:29179471-29179493 GAGGCGCCTGCAATGGGCCCAGG + Intergenic
1136332263 16:29587995-29588017 CAAGCTACTGCACTGGGCCACGG - Intergenic
1136446958 16:30328064-30328086 CAAGCTACTGCACTGGGCCATGG - Intergenic
1136497470 16:30653001-30653023 AAGGGCCCTCCTCTGGGCCAGGG - Exonic
1138108967 16:54308130-54308152 CAGAGGTCTGCAGTGGGCCAGGG + Intergenic
1139375390 16:66493573-66493595 CAGGGGCCAGGGCTGGGCCTGGG - Intronic
1139503487 16:67387301-67387323 CAGGTGCCTGGCCTGGGGCAGGG - Intergenic
1139692673 16:68651065-68651087 CAGGGGCCTTCCCTGGGCCTGGG + Intronic
1140057371 16:71537120-71537142 CAGGAGCCTGCAGTGAGCCCGGG - Exonic
1140833229 16:78770473-78770495 CTGGGATCTGGACTGGGCCATGG + Intronic
1141780891 16:86160130-86160152 CAGAGGCCTGTGTTGGGCCAAGG - Intergenic
1141954417 16:87360892-87360914 CAGGGCCCTGCACTGGGCCCTGG - Intronic
1142250291 16:88988883-88988905 CAGGGGTCAGCACTGGGTGATGG + Intergenic
1142506802 17:369553-369575 AAAGGGCCTGGCCTGGGCCAGGG - Intronic
1142558760 17:797387-797409 CATGGGCCTGCCCAGGGCAACGG + Intergenic
1142763065 17:2052443-2052465 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763087 17:2052513-2052535 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763108 17:2052583-2052605 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763130 17:2052653-2052675 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763152 17:2052723-2052745 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763174 17:2052793-2052815 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763195 17:2052863-2052885 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763216 17:2052933-2052955 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142763237 17:2053003-2053025 TAGGGGCCTGGGCTGGGGCAGGG + Intergenic
1142864028 17:2779626-2779648 CAGAGGCCAGCACTGGGCAGAGG + Intronic
1143027072 17:3947251-3947273 CCTGGACCTGCTCTGGGCCAAGG + Intronic
1143090128 17:4445177-4445199 CAGGGGCCTGGACAGGGGCATGG - Intronic
1143344726 17:6241367-6241389 CCGGGGGCAGCAGTGGGCCAAGG - Intergenic
1143491843 17:7289556-7289578 CAGGGGCCTGCTGGGGGCCAGGG + Exonic
1143972057 17:10803153-10803175 AAGGGGTGTGAACTGGGCCACGG - Intergenic
1144260095 17:13510131-13510153 GAGGGGCCTGCCCTTGGCCCAGG - Intronic
1144295511 17:13871486-13871508 CAGGGGCCAGCTTTGGCCCATGG + Intergenic
1144516026 17:15917937-15917959 CTCGAGCCTGCACTGGGCCCGGG + Intergenic
1144666870 17:17107956-17107978 CAGGGGCCTGCCCGGAGCCCTGG + Intronic
1144671196 17:17133557-17133579 CCCGGGCCAACACTGGGCCATGG - Intronic
1145211804 17:21018900-21018922 CAGGGACCTGCAGTGGGCTTGGG - Intronic
1147164883 17:38587761-38587783 CTGGGGGCATCACTGGGCCATGG - Intronic
1147238456 17:39074769-39074791 CTGAGCCCAGCACTGGGCCAGGG - Intronic
1147648037 17:42045664-42045686 TGAGGGCCTGAACTGGGCCAAGG - Intronic
1147867202 17:43560838-43560860 CAGCGGCCTGCCCTGGGAGAGGG - Intronic
1147925110 17:43941233-43941255 CAGGGGCAAGCACTGTGCCCAGG + Intronic
1147989467 17:44324279-44324301 CAGGTGCCTGCCCGGGGCCTTGG - Intronic
1148028578 17:44604972-44604994 TTGGGGCCAGCATTGGGCCAGGG - Intergenic
1148784097 17:50136884-50136906 CGGGGGCCTGGTCTGGGGCATGG - Intronic
1148862747 17:50613067-50613089 CAGGGGTGTCCTCTGGGCCAAGG + Intronic
1149682497 17:58515883-58515905 TAAGGGCCTGGTCTGGGCCAGGG + Intronic
1151335654 17:73438148-73438170 CAGGGGCCTGCAGAGGGCAAGGG + Exonic
1152178332 17:78802202-78802224 CATGGGCGTGCACTGGGCGAGGG - Intronic
1152564937 17:81096158-81096180 CAGGGGGCTGCCCAGAGCCACGG - Intronic
1152573549 17:81130715-81130737 CAGGGGTGGGCACTGGGGCAGGG - Intronic
1152625938 17:81387934-81387956 GAGGAGCCTGCCCCGGGCCAGGG - Intergenic
1152741428 17:82020118-82020140 CAGGGCCCTGCACAGGGTCTGGG + Intronic
1152754793 17:82082694-82082716 CTGTGGGCTGGACTGGGCCAGGG + Intronic
1152953441 18:13803-13825 CAGGGGCCAGCCATGGGACAAGG + Intergenic
1154346029 18:13544249-13544271 CAGAGTGCTGCAGTGGGCCAGGG + Intronic
1154437516 18:14358077-14358099 CAGGGGCCTCCGCTGGCCCCGGG + Intergenic
1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG + Intergenic
1157371557 18:47117499-47117521 GAAGGGCCTGCACTGGGTGAAGG - Intronic
1157753211 18:50195958-50195980 CAGGGGCCACCCCTGGGTCAGGG - Intergenic
1158276005 18:55768263-55768285 CAGGAGCCTCCACTGGGCTTTGG + Intergenic
1158499800 18:57990162-57990184 CACGGGCCAGTACTGGTCCATGG + Intergenic
1159607793 18:70493638-70493660 CAGGGAGCTGCACTGGGCCACGG + Intergenic
1159950562 18:74479676-74479698 CAGCAGCCTCCCCTGGGCCAGGG - Intergenic
1160239665 18:77113973-77113995 CAGGAGCCAGCCCTGGGCTAGGG + Intronic
1160470464 18:79128200-79128222 CAGGTGCCTGCACTGCGCCCGGG + Intronic
1160810440 19:1010795-1010817 CAGGCGCCGCCACTGGGCCCCGG - Exonic
1160817514 19:1042964-1042986 CAGGGCAGGGCACTGGGCCAGGG - Intronic
1160959503 19:1713050-1713072 CAGGGCCCTGCTCTGTGCCCAGG - Intergenic
1161015305 19:1980204-1980226 CAGGGGGCTGCACGCGCCCAGGG - Exonic
1161234370 19:3190548-3190570 CCGGGGCCTGCGCTGAGCCTCGG - Intronic
1161327556 19:3670945-3670967 AAAGGGCCTGCTCTGGGCCGCGG + Intronic
1161454477 19:4363148-4363170 CCGGGGCCTGCATCGGGGCAGGG + Intronic
1161490123 19:4556919-4556941 CAGGGGCCGGGACCGAGCCAGGG + Intronic
1161607789 19:5224418-5224440 CAGGTGCCTGCATTGAGCAAGGG - Intronic
1161803995 19:6431805-6431827 CAGGGACCAACGCTGGGCCAAGG - Intronic
1161872146 19:6878412-6878434 CAGTGGCCTGGTCTGGGGCAGGG - Intergenic
1161898443 19:7099698-7099720 CAGGGGACTGCAGTGGGGAAGGG + Intergenic
1162148169 19:8626263-8626285 AAGGGGCCTGCACCTGGCAAGGG - Intergenic
1162191553 19:8950963-8950985 CTGTGGTCTTCACTGGGCCAAGG + Exonic
1162464313 19:10831184-10831206 CAGGGGCCGGCCCTGGACCGGGG - Exonic
1162604292 19:11694842-11694864 CAGGGACCTGCACTGGTCGTGGG - Intergenic
1162926971 19:13935693-13935715 TGGGGGCCTGGGCTGGGCCAGGG + Intronic
1163000165 19:14362218-14362240 GAGGAGTCTGCACTGGGCCAAGG + Intergenic
1163034321 19:14562587-14562609 GCGTGGGCTGCACTGGGCCAAGG + Intronic
1163646641 19:18493347-18493369 GAGGGGCTTGCCCTGGGCCCTGG + Intronic
1164538983 19:29108099-29108121 CTGGAGACTGCACAGGGCCAGGG - Intergenic
1165062837 19:33213121-33213143 CAGAGGCCAGCACCGGTCCAGGG + Intronic
1165152812 19:33770962-33770984 CAGTGGCCAGAACTGGGGCATGG + Intronic
1165281603 19:34802896-34802918 GAGGAGCCAGCACTGGCCCAGGG + Intergenic
1165533279 19:36421757-36421779 CATGGGGCTGCTCTGGGCCCTGG + Intergenic
1166369859 19:42294673-42294695 CAGGGCCCGGCGCTGGTCCAGGG - Exonic
1166393876 19:42424862-42424884 CAGGGGGCAGCACTGGGCCCCGG + Intronic
1167779606 19:51590615-51590637 CAGGAGCCTGTGCTGGGCCCTGG + Exonic
1167915104 19:52734421-52734443 CAGGGGCCTGTCCTGCGGCACGG - Intronic
1168350825 19:55674781-55674803 CAGGGGCCCGCAGTTTGCCAAGG - Intergenic
925848036 2:8051687-8051709 CAGGGGTCTGCCCTGGGACAAGG + Intergenic
926146226 2:10398575-10398597 CCGGGGTCTGCCCTGGGCCCTGG - Intronic
926209982 2:10862524-10862546 CAGGAGCCCACACTGTGCCATGG + Intergenic
926305838 2:11636879-11636901 CAGGGGCATGGACAGAGCCAGGG + Intronic
926528159 2:14008401-14008423 CAGGGGCCTGAACAGGTACAGGG + Intergenic
926723840 2:15982519-15982541 CTTTGGCCTGGACTGGGCCAGGG + Intergenic
926843128 2:17105119-17105141 CAGGGCCCTTCCCAGGGCCAGGG - Intergenic
927450553 2:23205961-23205983 CAGGAGACTGCAGTGTGCCAAGG - Intergenic
928391007 2:30910912-30910934 CATGAGCCAGCACTGGGACATGG - Exonic
929452282 2:42046146-42046168 CAGGGGTCTGAATTGGACCAAGG + Intergenic
930003873 2:46880934-46880956 CAGAGGTTTGCTCTGGGCCAGGG + Intergenic
931615468 2:64152173-64152195 CAGGGTCCTGCTCTGTGCCCAGG + Intergenic
933284688 2:80373066-80373088 CAGGGCTAGGCACTGGGCCATGG - Intronic
933690345 2:85174841-85174863 CAGGGACCTGCAGTGACCCAAGG - Intronic
933851240 2:86368391-86368413 CAGGGTCCTTCTCTGGGACAGGG - Intergenic
934460860 2:94213216-94213238 CCGGGGCCAGAACTGAGCCAGGG - Intergenic
934487124 2:94725706-94725728 CAGGGGCCTCCCCTGGCCCCGGG + Intergenic
934542409 2:95186835-95186857 CCGGGGCCTGCTGTGGGGCAGGG - Intergenic
935346324 2:102111748-102111770 CAGGGGCCTGCTTGGTGCCAGGG + Intronic
936022029 2:109002231-109002253 CAGGAGCAAGCACAGGGCCAGGG - Intergenic
936093619 2:109516091-109516113 CAGGGGTCTTCCCTGGGCTAAGG + Intergenic
936566048 2:113583687-113583709 CAGGGGCGGGCCCTGGGCCTGGG + Intergenic
937034375 2:118768824-118768846 GAGGGACCTCCACAGGGCCAGGG - Intergenic
937060667 2:118978209-118978231 AGTGGGCCTGCACTGGGCCTTGG + Intronic
937323933 2:120977810-120977832 CAGTGGCCTGCACAGGGCCCTGG - Intronic
937761117 2:125604428-125604450 CAGGGGGCTGCCCAAGGCCATGG + Intergenic
941656001 2:168145420-168145442 CAGGGGCCTGCCTTGGACCTTGG - Intronic
945470640 2:210224856-210224878 CAGCGGCCTGCAGTGGGACCCGG - Intronic
945803658 2:214464738-214464760 CTGGGACCTGCTCTGGGCCAGGG - Intronic
945974450 2:216259461-216259483 CAGGGCCCTGCTCAGGGGCAGGG + Exonic
946249457 2:218403638-218403660 CAGGGGCCCCCACAGGGCAACGG + Intronic
946440674 2:219692666-219692688 CAGGAGCATTCACTGGGACAGGG - Intergenic
947398505 2:229710534-229710556 CACGTGCCTGCACTGTTCCAAGG - Intronic
947534406 2:230931822-230931844 CAGGCGAATGGACTGGGCCAGGG - Intronic
948226195 2:236311094-236311116 CAGAGACCTGCACTTGGCCAAGG - Intergenic
948669934 2:239561748-239561770 CACAGGCCTGCACTGGGCAGTGG + Intergenic
948800708 2:240432254-240432276 CCAGGGCCTGCTCTGGCCCATGG - Intergenic
948921786 2:241069298-241069320 CAGAGGACCTCACTGGGCCAGGG + Intronic
948995686 2:241577066-241577088 GTGGGGCCTGCCCGGGGCCATGG - Intergenic
1168831446 20:847271-847293 CAGGGGCCTGGGATGGGCCTGGG + Intronic
1169029526 20:2396784-2396806 CCAGGGCCTGCACTGGGTCCTGG + Intronic
1169246297 20:4027869-4027891 CAAGGTCCTGTGCTGGGCCAGGG + Intergenic
1169386080 20:5150628-5150650 CACAGGCCTGCACTGCTCCAGGG - Intronic
1169908293 20:10625168-10625190 GAGGCGCCTACAGTGGGCCATGG - Exonic
1171213517 20:23335085-23335107 CAGAGGCCTCCACTGGCCCCTGG - Intergenic
1171415747 20:24979427-24979449 CAGGAGCCTGAGCTGGGCCCTGG + Intronic
1172642213 20:36447211-36447233 CAGGTGGCTGCTCTGAGCCAAGG - Intronic
1172700041 20:36847505-36847527 CAGGTACCTGCTCTGTGCCACGG - Intronic
1173543071 20:43869137-43869159 CACAGGCCTGCTCAGGGCCAAGG + Intergenic
1173931276 20:46821306-46821328 CAGGGGCCAGCTTTGGGGCAGGG + Intergenic
1174130335 20:48339962-48339984 CAGGGGCCAGTTCTGGGACAGGG - Intergenic
1174540389 20:51284876-51284898 CAGGGTCGGGCACTGGGCTAAGG - Intergenic
1175216638 20:57394780-57394802 CAGGCGCCTGCTGTGGGCCTGGG - Intronic
1175223870 20:57433625-57433647 CAGGGGCCTGCAGAGGCCCTGGG - Intergenic
1175443751 20:59007125-59007147 CAGGAGCCGGCGCGGGGCCATGG - Exonic
1175783227 20:61696666-61696688 CATGGGGCTGCCCTGGCCCAGGG + Intronic
1175921222 20:62451369-62451391 CAGGGGTCTCACCTGGGCCATGG + Intergenic
1176044750 20:63086774-63086796 CCAGGCCCTGCACTGGCCCACGG - Intergenic
1176147877 20:63573541-63573563 CTGGGGGCGGCACTGTGCCAAGG - Intronic
1176369439 21:6053598-6053620 CCGGGGCCTCCTCTGGGCTAGGG - Intergenic
1176426659 21:6552686-6552708 CAGGGGCCAGCCCTGCCCCATGG + Intergenic
1176839535 21:13827567-13827589 CAGGGGCCTCCACTGGCCCCGGG - Intergenic
1178872087 21:36385515-36385537 CAGGGGCCCGCCCTCGGCGAGGG - Intronic
1178912975 21:36691391-36691413 GAGTGGCCTGCGTTGGGCCATGG - Intergenic
1179487788 21:41722081-41722103 CAAGGGCCAGCACTGGGGCAGGG - Intergenic
1179702150 21:43161008-43161030 CAGGGGCCAGCCCTGCCCCATGG + Intronic
1179754080 21:43484943-43484965 CCGGGGCCTCCTCTGGGCTAGGG + Intergenic
1179913623 21:44462809-44462831 CCAGGGCCTGGACAGGGCCAGGG - Intergenic
1179934396 21:44592950-44592972 CATTGACCTGCCCTGGGCCATGG + Intronic
1180099144 21:45576236-45576258 CAGGGGAATGAGCTGGGCCAGGG - Intergenic
1180127460 21:45802144-45802166 AAAGAGCTTGCACTGGGCCAAGG - Intronic
1180135792 21:45861030-45861052 CAGGGGCCTCCACAGGGCCCAGG - Intronic
1180707075 22:17816654-17816676 CAGGGGGCTTCACAGGGCCTGGG - Intronic
1180919342 22:19512250-19512272 CAGGTGAGTGCAGTGGGCCAAGG - Intronic
1180951022 22:19720684-19720706 CAGGGGCCTGGCCAGGGCCCTGG + Intronic
1180964047 22:19776461-19776483 CAGGGGCCTGCACGGGGTGGAGG + Intronic
1181276132 22:21688489-21688511 CTGGGGCCTGCCCCGGGACAGGG - Intronic
1181637893 22:24182696-24182718 CAGGGGTCCTCAGTGGGCCACGG - Intronic
1181747725 22:24967529-24967551 CCAAGGCCTGCACTGGGCCTTGG + Intronic
1182120601 22:27784044-27784066 CAGGGGCCGGCTCTCTGCCAAGG - Intronic
1182288355 22:29260764-29260786 CAGGGGCCAGCACCCCGCCAAGG + Exonic
1183044784 22:35211069-35211091 CAGGAGCCTGCACTGTTGCAGGG - Intergenic
1183351920 22:37339238-37339260 CCAGGGCCTGAGCTGGGCCAGGG - Intergenic
1183356849 22:37364298-37364320 CAGGGCCAGGCACAGGGCCACGG + Intergenic
1183371491 22:37435085-37435107 CAGGGGTGGGCACTGGGCAAAGG + Intergenic
1183748579 22:39706188-39706210 CAGGGGCCTCCGCAGGGCCCAGG - Intergenic
1184240120 22:43207444-43207466 CAGGGGCCAGGGCTGGGGCAGGG + Intronic
1184252399 22:43268179-43268201 CAGAAGCCTGCTCTGGGCCTGGG - Intronic
1184601828 22:45548517-45548539 CTGGGGGCTGCACTGGGGCCCGG - Intronic
1184870183 22:47232864-47232886 CCGGGGGCTGTTCTGGGCCAGGG + Intergenic
1184890027 22:47373854-47373876 CACAGTCCTGCCCTGGGCCATGG + Intergenic
1184934884 22:47714002-47714024 CAGGGGCCAGCCCTGTCCCAGGG + Intergenic
1185163590 22:49244213-49244235 CAGGGTCCTGCTCGGGGCCCAGG - Intergenic
950137510 3:10592038-10592060 CTGAGGCCTGCACTGGTCCAGGG + Intronic
950573917 3:13819468-13819490 CTGGGGGCTGCACTTGGCCTTGG - Intronic
953317175 3:41939707-41939729 CATGGACCTGGACTGGTCCATGG - Intronic
954240879 3:49292523-49292545 CAGGGGCCTGCAATGGCTCCAGG - Exonic
956766992 3:72492278-72492300 CAGGGGCCTGGGCTGGGTCCAGG + Intergenic
957909060 3:86598349-86598371 CAGTTGACTGCACTAGGCCAGGG - Intergenic
958425041 3:93970201-93970223 GAGTAGCCTGCACTGGCCCAGGG + Intronic
960552275 3:118989258-118989280 CACAGGTCTGCACTGGTCCAGGG - Intronic
960946051 3:122967504-122967526 CAGGAGTCTGCACTGGGTTAAGG - Intronic
961347443 3:126273384-126273406 CAGGGGCTTGAGCTGGGGCAGGG + Intergenic
961602388 3:128071943-128071965 CAGAGGCCTCCGCTGAGCCAGGG + Intronic
961603565 3:128077696-128077718 GAGGGGCCAGCACTGGCTCAGGG - Intronic
962532801 3:136298894-136298916 GTGGGGCCTGGTCTGGGCCAGGG + Intronic
962989623 3:140566297-140566319 CATGGGCATACACTGGGTCAGGG - Exonic
963746946 3:149134138-149134160 CAGGGGCCTGCACTGGGCCACGG + Intronic
966285217 3:178287311-178287333 CAGGGACCTCCTCTGGCCCATGG - Intergenic
966510822 3:180761260-180761282 CATGGGTCAGCACTGGTCCATGG - Intronic
967166476 3:186784040-186784062 CAGCGGTCTCCACTCGGCCACGG + Intronic
967367571 3:188705012-188705034 CAGGGTCCTTCACTTGGCCTGGG + Intronic
967781461 3:193444905-193444927 CAGGGGCCTGCTGTGGAGCATGG - Intronic
967955792 3:194876553-194876575 AGTGGGCCTGCCCTGGGCCAAGG + Intergenic
968204824 3:196790019-196790041 CATGGACCTGTACTGGTCCACGG + Intronic
968484072 4:850355-850377 CTGGGGCCTGGGATGGGCCAAGG - Intronic
968655042 4:1774801-1774823 CAGGCCCCCACACTGGGCCACGG - Intergenic
968735263 4:2291863-2291885 CATGGTGCTGCACTGGGCCAAGG + Intronic
968757407 4:2423906-2423928 CGGGAGCCTGCCCTGGGCCCCGG - Intronic
969106422 4:4810329-4810351 CAGGGGCCTGAAATAGGCCAGGG + Intergenic
969264933 4:6058053-6058075 CAGGTACCAGCACTGGGCCTGGG + Intronic
971409900 4:26359521-26359543 CAGGGGCCTGCAGTTTGCCAAGG - Intronic
973829864 4:54747791-54747813 CAGGGACCGGTACTGGTCCATGG - Intergenic
977919298 4:102625716-102625738 GAAGGGACTGCCCTGGGCCAGGG - Intergenic
978076160 4:104532841-104532863 CAGGAGCCAGCACAGGGCAAAGG + Intergenic
979487196 4:121283285-121283307 CAGGGGCTTGCCTTGGGCCTGGG - Intergenic
981188020 4:141828025-141828047 CTGGGGCCTGCATTGGGCCTAGG + Intergenic
982402332 4:154982355-154982377 CAAGGGGCTGCAGTGGGCAAAGG - Intergenic
983943974 4:173565681-173565703 CATTTGCATGCACTGGGCCAAGG - Intergenic
984610294 4:181829713-181829735 TAGGGGCTGGCACTGGGACATGG - Intergenic
985484984 5:143423-143445 CAGGAGCCTGCTCTGGACCAGGG + Exonic
985493535 5:192499-192521 CAGGGGCCTGCTCATGTCCAAGG + Intronic
985533411 5:447222-447244 CACGGGTCTGCCCTGGGCCGTGG - Intronic
985539800 5:482649-482671 CGGGGGCCTGCGCGGGGCCGTGG - Exonic
985693369 5:1325910-1325932 CAGTGGGCTGCGCGGGGCCATGG - Intronic
985782608 5:1878963-1878985 CAGGGGCCTCCAATGGGGGAGGG + Intronic
985947279 5:3196077-3196099 CAGGAGCTTGCCTTGGGCCACGG + Intergenic
986197967 5:5555266-5555288 CATGGACCAGTACTGGGCCATGG + Intergenic
986310348 5:6546567-6546589 CAGGGACATCCACTGGGCCCTGG + Intergenic
986476065 5:8134782-8134804 CAGGGGCTGGCACTGGGACTTGG - Intergenic
986650796 5:9961608-9961630 CAGGGGCCTGAATTCTGCCAAGG + Intergenic
986745118 5:10736950-10736972 CAGAGCCCTGCACTGGCCAAAGG - Intronic
987131377 5:14863286-14863308 CAGGGCTCAGGACTGGGCCAAGG + Intronic
989270896 5:39531671-39531693 CAGGGGCATGAGGTGGGCCATGG + Intergenic
989472525 5:41836810-41836832 CATGGACCTGTACTGGCCCATGG - Intronic
992015380 5:72569980-72570002 CAGGGGCCTGCTGGGGGACACGG - Intergenic
992347209 5:75891906-75891928 GAGGGGCCTGCAATGGTCCCTGG + Intergenic
992385547 5:76280761-76280783 GATGAGCCTGCTCTGGGCCAGGG - Intronic
993913148 5:93708688-93708710 CAGGGACCAGTACTGGTCCATGG + Intronic
994349238 5:98725498-98725520 CAGGGGAGTGTACAGGGCCATGG - Intergenic
994632658 5:102305228-102305250 CAGGGACTAGTACTGGGCCATGG - Intergenic
994934633 5:106238409-106238431 CAGGGGAGTGCCCTAGGCCAGGG - Intergenic
996322148 5:122230749-122230771 CAGGGACCAGTACTGGTCCACGG + Intergenic
996774769 5:127121374-127121396 CAGGGACCTGCACCTGGCCCAGG + Intergenic
998795044 5:145809488-145809510 CAGGGCCCTGCATAGGCCCATGG - Intronic
999804272 5:155067396-155067418 CAGGACCCTGCACTCTGCCATGG - Intergenic
1001753369 5:174148002-174148024 CAGGGGCAGGCATTGGGGCAGGG + Intronic
1002060028 5:176620603-176620625 CCGGGGCATGGACAGGGCCAGGG - Exonic
1002417962 5:179130578-179130600 CTGGGGCCTCGGCTGGGCCATGG - Intronic
1002581482 5:180211798-180211820 CAGGTGCCACCACTGGGCCCTGG + Intergenic
1002605431 5:180380346-180380368 CAGGGGCCTTCTCTGTTCCAGGG - Intergenic
1003127015 6:3363563-3363585 CAGGTGCCCACACTGGGCCCAGG - Intronic
1003163004 6:3651948-3651970 CAGGTGCCTGCACTGCTCCTGGG - Intergenic
1003405537 6:5824370-5824392 CAGAAGCCTGCTCTGGGGCATGG - Intergenic
1004090443 6:12494863-12494885 CAGGGGGCTACCCAGGGCCAGGG - Intergenic
1004310483 6:14540770-14540792 CAGGGGGCTTAACTGGGCTAGGG + Intergenic
1004897113 6:20159165-20159187 CATGGGCCAGTACTGGTCCATGG + Intronic
1006152996 6:31999199-31999221 CCGGGAGCTGCCCTGGGCCAGGG + Intronic
1006159304 6:32031936-32031958 CCGGGAGCTGCCCTGGGCCAGGG + Intronic
1006191484 6:32212473-32212495 CAGAAGGCTGCACTGAGCCAAGG - Exonic
1006326749 6:33360078-33360100 CATGGGCCTGCCATGGGGCATGG + Intergenic
1007734233 6:43970716-43970738 CAGGGGCCTGGCCTGGTCCTTGG + Intergenic
1010174201 6:73007634-73007656 CAGCTGCCTGCAATGGGCCTGGG - Intronic
1015790209 6:136957986-136958008 CCAGGGCCTGCACTGGGGCAGGG - Intergenic
1017713400 6:157190220-157190242 GAGGGGCCTCCACCCGGCCATGG + Intronic
1017890750 6:158636878-158636900 CAGGGAGCTGCACTGTGCGATGG - Exonic
1018029584 6:159831500-159831522 CAGGTGCTTCCACTGGGCCCTGG - Intergenic
1018898224 6:168035921-168035943 GAGAGGGGTGCACTGGGCCAGGG + Intronic
1018975730 6:168563903-168563925 CAGGGGCCTGCAGGGGGCGGGGG + Intronic
1019054566 6:169213837-169213859 CAGGTACCTGCCCTGGGCTAAGG + Intergenic
1019171980 6:170137848-170137870 CAGGCGTCTGCCCTGGGCCCCGG - Intergenic
1019300208 7:299219-299241 CATGGGCCTGCACTGGTCCCTGG + Intergenic
1019306503 7:337850-337872 CAGGCTCCTCCACTGGTCCAGGG - Intergenic
1019363509 7:618051-618073 GAGGAGCCTGCACTGGTCCTGGG - Intronic
1019436537 7:1025146-1025168 CAGGAGGCAGCTCTGGGCCAGGG + Intronic
1019594077 7:1850389-1850411 CAGGGGGCTGAGCTGGGCCCAGG - Intronic
1022031762 7:26498383-26498405 CAGGCCCCTGCTCTGGGGCACGG + Intergenic
1022497296 7:30861128-30861150 CAGAGGCCTGTACTGCCCCAGGG - Intronic
1023446685 7:40239152-40239174 CAGGAGGCTGCAGTGTGCCACGG - Intronic
1023941265 7:44769565-44769587 CTGGGGCCTGCATCAGGCCATGG - Exonic
1024593846 7:50915717-50915739 CAGGGCCCTGCACAGAGCAAGGG + Intergenic
1026959318 7:74398569-74398591 CAGGGCCCAGCCCTGGGCAAGGG + Intronic
1027190524 7:75993570-75993592 CAGGGGCCTTGGCAGGGCCAGGG + Intronic
1027532562 7:79354064-79354086 CATGAGCTTCCACTGGGCCAGGG - Intronic
1029125704 7:98293928-98293950 CAGGGGGCTGCACTCCCCCATGG + Intronic
1029151913 7:98486192-98486214 CCTGGGTCTGCACTGGGCCCGGG + Intergenic
1029307812 7:99633805-99633827 CAGGGGCCTCCACTGGTCAAAGG - Intergenic
1029691282 7:102183656-102183678 CAGACCCCTGCCCTGGGCCAGGG + Intronic
1030391258 7:108931312-108931334 ATGGGGTCTGCACTGGCCCAGGG + Intergenic
1034729886 7:153377935-153377957 CAGAGGCCAGCACTGAGCCTAGG - Intergenic
1035633715 8:1127649-1127671 CAGGGTTCTGCACAGGGACAGGG - Intergenic
1035759913 8:2061638-2061660 CAGGAGCCTGCATGGGGCCTGGG + Intronic
1036645340 8:10608870-10608892 CAGGGGCCTGGAGTGGACGAGGG - Exonic
1037668928 8:20997726-20997748 CAGGGGCCTGCCCTTGGGGAAGG + Intergenic
1037686179 8:21141498-21141520 CAGGGGCCTGCCTTGGCCCTTGG + Intergenic
1038412452 8:27368831-27368853 CATGTGCCTGCCCTGGGCCCCGG + Intronic
1039611336 8:38921627-38921649 TAAGAGCCTGCCCTGGGCCAGGG - Intronic
1040323116 8:46328399-46328421 CAGGGGCGTTCCCTGGGTCAGGG - Intergenic
1041770940 8:61471912-61471934 GAGGGGCCTGCAGGAGGCCAGGG - Intronic
1041839210 8:62249145-62249167 CAGGGACCTGTCCTGGGGCAGGG - Intronic
1042863966 8:73340694-73340716 CAGGGCTCTGCACAGGGCAAGGG - Intergenic
1046654693 8:116880445-116880467 CAGGGGCCAGGAGTGGGCCCAGG + Intergenic
1047286987 8:123495874-123495896 CATGGACCAGCACTGGCCCATGG - Intergenic
1048159700 8:132004266-132004288 CAGAGACCTGTACTGGCCCATGG + Intronic
1048201114 8:132374458-132374480 CGGGGGGCAGTACTGGGCCAAGG - Intronic
1048548240 8:135406700-135406722 CAGGAGGCTGCACTAGGTCAAGG + Intergenic
1048861944 8:138730165-138730187 CAGGGACCTGCACATGGGCAGGG - Intronic
1049195699 8:141314530-141314552 CATGGGCCCGCCCTGGGCAAAGG + Intergenic
1049236243 8:141513824-141513846 CAGGGGCCTGAGCTGGGGCCTGG - Intergenic
1049385818 8:142342461-142342483 CACTGGGCTGCAGTGGGCCAAGG - Intronic
1049623663 8:143610591-143610613 CTGGGCCCTGCTCTGGGCCTGGG + Intergenic
1049705480 8:144040224-144040246 CAGGGGGCTGCTCTGGGACATGG - Exonic
1049733792 8:144192645-144192667 ACTGGGCCTGCACTGGGCCTGGG - Intronic
1052049767 9:23831440-23831462 CAAGTGCCGGCACCGGGCCACGG + Intergenic
1052234543 9:26194193-26194215 CATGGACCAGCACTGGTCCATGG + Intergenic
1053147995 9:35724982-35725004 CAGGGGCCTACTCTGAGCTAGGG + Intronic
1053278575 9:36801576-36801598 CCGGGGCATGCCCTTGGCCATGG + Intergenic
1053433455 9:38059202-38059224 CAAGGCCCGGCAGTGGGCCAGGG + Intronic
1053509272 9:38673313-38673335 CAGGGCCTTGCACTTGGCGATGG + Intergenic
1053556744 9:39145537-39145559 CAGGGGCCTGTATTTGGCCTCGG + Intronic
1053820854 9:41965815-41965837 CAGGGGCCTGTATTTGGCCTCGG + Intronic
1053920470 9:42984996-42985018 CAGGGGCCTCCCCTGGCCCCGGG - Intergenic
1054089724 9:60833954-60833976 CAGGGGCCTGTATTTGGCCTCGG + Intergenic
1054111135 9:61109512-61109534 CAGGGGCCTGTATTTGGCCTCGG + Intergenic
1054609722 9:67221613-67221635 CAGGGGCCTGTATTTGGCCTCGG - Intergenic
1054906989 9:70420539-70420561 CAGGATCCAGCACTGGGCCTGGG - Intergenic
1056311859 9:85348904-85348926 GAAGGGCCTGCCCTGGGCCTTGG - Intergenic
1056655156 9:88502949-88502971 CAGAGGCTTGCTCTGGGACAAGG + Intergenic
1056664724 9:88572379-88572401 AACGGGCCTGAAATGGGCCATGG + Intronic
1056737470 9:89222206-89222228 CAAGGGCCAACACTGTGCCATGG + Intergenic
1057142568 9:92736362-92736384 CTGGGGCCATCACAGGGCCATGG - Intronic
1057274507 9:93669205-93669227 CGGGGGCCTGCACTTAGCCACGG - Intronic
1057574148 9:96228002-96228024 CAGAGGCCCTCACTGGGGCAGGG - Intergenic
1057915532 9:99052495-99052517 CTGCGCCCTGCACTGGGCAAAGG - Intronic
1059486313 9:114629706-114629728 CAGAGTCCAGCACTGTGCCAGGG - Intronic
1060175056 9:121491531-121491553 CAGGGGCCTGATCCTGGCCAGGG - Intergenic
1060578051 9:124716135-124716157 GAGGAGGCTGCAGTGGGCCATGG + Intronic
1060810845 9:126610833-126610855 CAGGAGCCGGCTCTGGGCCTCGG + Intergenic
1061027961 9:128062847-128062869 CAAGGGCCTGCGCTGTGCCTGGG + Exonic
1061062556 9:128257991-128258013 CCGGGCCCTGCAGGGGGCCATGG - Exonic
1061071638 9:128314390-128314412 CAAGGGCCTGATCTGGGCCATGG - Intronic
1061176615 9:129001537-129001559 CCTGGGCCTGCACCTGGCCAAGG + Exonic
1061187023 9:129060712-129060734 ATGGGGCCAGCACTGGGTCATGG + Intronic
1061272077 9:129549468-129549490 CTGGGCCTTGCACTGGGCCCTGG - Intergenic
1061799678 9:133106996-133107018 CTGGGGCCTGTACAGGGCCTTGG + Intronic
1061879462 9:133561502-133561524 CAGGGGCCTGGACCTGACCATGG - Intronic
1061924255 9:133798218-133798240 CCGAGGCCTGCACTGGCTCAGGG + Intronic
1062038985 9:134395601-134395623 CAGGCCCCTGCTCTGAGCCAGGG - Intronic
1062095866 9:134703018-134703040 CTGCGGTCTGCACTGGGCCGCGG - Intronic
1062325409 9:136010352-136010374 CAGCGGCCAGGGCTGGGCCAGGG - Exonic
1062340286 9:136091019-136091041 CAGGGCCCCGCACTGGGGGAGGG + Intronic
1062389991 9:136330064-136330086 CAAAGCCCTGCTCTGGGCCAGGG - Intronic
1062404251 9:136387374-136387396 CAGCGGCCAGCGCTGGGCGAGGG - Intronic
1062442829 9:136578792-136578814 CAGGGGCCTGGCCTGGGGCGGGG + Intergenic
1062443374 9:136583424-136583446 CTGGTGCCTGCACTGGGCCCGGG - Intergenic
1062481623 9:136755068-136755090 CAGGGCCAGGGACTGGGCCAGGG + Intronic
1062523510 9:136969277-136969299 CTGGAGCCTGCCCCGGGCCAGGG + Exonic
1062561364 9:137143546-137143568 CTTTGGCCTGCTCTGGGCCAGGG - Intronic
1203780984 EBV:100754-100776 CAGGGTCTTGTACTGGGCCAGGG + Intergenic
1187252903 X:17615041-17615063 CAAGAGCCTGCCCTGGGACAGGG - Intronic
1189478250 X:41373857-41373879 GAGGGGCCTGAACTTGGCCTGGG - Intergenic
1190732339 X:53234293-53234315 CAGAGGCGTGCAGCGGGCCATGG + Exonic
1192190510 X:68988618-68988640 ATGGGGGCAGCACTGGGCCAGGG - Intergenic
1192806220 X:74511853-74511875 CTGGGCCCTGCACAAGGCCAGGG + Intronic
1195111358 X:101653819-101653841 CAGGGACCTGCAGTAGTCCATGG + Intergenic
1195247455 X:103007444-103007466 GAGGAGCCTGCACCGGACCATGG + Intergenic
1196443789 X:115735157-115735179 CAGGGTCCCGCAGTGGGCCAGGG + Intergenic
1198069941 X:133138423-133138445 CAGGGGACTGAACTGGGGAAGGG - Intergenic
1199416014 X:147584032-147584054 TAGAGGCCTGCAGTGGGTCATGG - Intergenic
1200163509 X:154020694-154020716 CAGGGGCCAGCTGTGGGCCTTGG - Intergenic