ID: 963747590

View in Genome Browser
Species Human (GRCh38)
Location 3:149141268-149141290
Sequence GGGTTTAAAAAGACAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 809
Summary {0: 1, 1: 0, 2: 1, 3: 78, 4: 729}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963747590 Original CRISPR GGGTTTAAAAAGACAGAGAA AGG (reversed) Intronic
901766371 1:11502449-11502471 GGGTTGAAGAAGACTGAGATAGG + Intronic
901774088 1:11547353-11547375 GGTGTTCAAAAGACAGAGAGTGG + Intergenic
902906249 1:19560016-19560038 TGGATTAAGAAGAGAGAGAAAGG - Intergenic
903005444 1:20295152-20295174 AGGTTTCAAAACACAGAGATGGG + Intronic
903192558 1:21665042-21665064 GGGTCTAAAAGGACATAGATTGG - Intronic
903370163 1:22830155-22830177 GGCTCCAAAAATACAGAGAAAGG + Intronic
903662391 1:24986124-24986146 GGGTCTTAGAAGAAAGAGAAGGG + Intergenic
904089014 1:27931463-27931485 GGGTTTAAAAATACAGTTAGAGG + Intergenic
904986329 1:34552051-34552073 AAATTTAAAAAGACAAAGAAGGG + Intergenic
905069488 1:35212801-35212823 GGGTTTAAATAGACTGGGAATGG - Intergenic
906287386 1:44596258-44596280 AGAAGTAAAAAGACAGAGAAGGG + Intronic
906585574 1:46974687-46974709 TGATTAAAAAAGACAAAGAAAGG - Intergenic
906905926 1:49892283-49892305 AGCTTTAACAAGTCAGAGAAAGG - Intronic
907027311 1:51133440-51133462 GATTTTAAAAAGACAAAGAAAGG + Intronic
907191223 1:52650621-52650643 GGGTTTTAAAAAAAAGAAAATGG - Intronic
907508069 1:54936461-54936483 GGATAAAGAAAGACAGAGAAAGG - Intergenic
907910442 1:58821265-58821287 AGATATAAAAAGACAGAGTAGGG + Intergenic
908818773 1:68060588-68060610 AATTTTAAAAAGACAAAGAAGGG + Intergenic
908935526 1:69371728-69371750 AGATTTAAAAAGACAAAGAATGG - Intergenic
909166118 1:72227555-72227577 GAGTTTAAAAAATCTGAGAATGG + Intronic
909661364 1:78086681-78086703 AGATCAAAAAAGACAGAGAAGGG - Intronic
910619118 1:89233998-89234020 AGGTCAAAAAAGACAAAGAAGGG - Intergenic
910812941 1:91256265-91256287 AGATTTAAAAAGACAAAGAAGGG + Intergenic
911287571 1:96015443-96015465 GGGTTTGAAATGACAGAAATGGG - Intergenic
911301089 1:96175161-96175183 TTTTTTAAAAAGTCAGAGAAAGG + Intergenic
911360567 1:96871268-96871290 AATTTTAAAAAGACAAAGAAAGG - Intergenic
911667446 1:100569497-100569519 TGGTTTTAAAAAACAAAGAAAGG + Intergenic
911794744 1:102061021-102061043 GGATCAAAAAAGACAAAGAAGGG + Intergenic
911835400 1:102612494-102612516 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
911856210 1:102879320-102879342 GATTTTAAAATGACAGATAAAGG - Intronic
911940910 1:104046424-104046446 CAGTTAAAAAAGACAAAGAAGGG - Intergenic
911949571 1:104155014-104155036 GGGTTTCAACATACAGTGAAAGG - Intergenic
912220782 1:107672474-107672496 GTGTTTAATAAGTCAGAGGAGGG + Intronic
912276563 1:108264275-108264297 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
912291665 1:108430082-108430104 AGGTCAAAAAAGACAAAGAAGGG - Intronic
912417562 1:109520396-109520418 GAGCTTAGGAAGACAGAGAAGGG + Intergenic
913718025 1:121558297-121558319 GGGAAGAAAAAGAAAGAGAAAGG - Intergenic
913989776 1:143600136-143600158 GTGTTTTAAAAGAAAAAGAACGG + Intergenic
914238325 1:145832721-145832743 GAGTTAAAATAGAGAGAGAAAGG + Intronic
914399909 1:147308839-147308861 GGATAAAAAAAGACAAAGAAGGG + Intergenic
915688694 1:157664029-157664051 AGATCAAAAAAGACAGAGAAGGG + Intergenic
915815968 1:158965125-158965147 AGAGTTAAAAAGACAAAGAAGGG + Intronic
916582064 1:166117834-166117856 GGGTTCTAAAAGACAGAGTCAGG + Intronic
916583575 1:166130033-166130055 GGGTTTCAGTAGACAGAGATAGG - Intronic
916912035 1:169361174-169361196 GGGAATAAAAAGGCAGAAAAAGG + Intronic
917326726 1:173840884-173840906 GTGTTTAGAAACACAGAGATTGG + Exonic
917627265 1:176859184-176859206 GGGAAAAGAAAGACAGAGAAGGG - Intronic
918273068 1:182922034-182922056 GATTTTAAAAAGACAAAGAATGG + Intronic
918315699 1:183320976-183320998 AACTTTAAAAAGACACAGAAAGG - Intronic
918856605 1:189763459-189763481 CATTTTAAAGAGACAGAGAAAGG - Intergenic
919500215 1:198329044-198329066 GTGGTTTAAAAGACAGAAAAGGG + Intergenic
919520311 1:198580413-198580435 CAGTTAAAAAAGACAGAGAGGGG - Intergenic
920671196 1:208004755-208004777 GGGTAGTAGAAGACAGAGAAGGG - Intergenic
920774742 1:208925005-208925027 CGATTTAAAAACACAGAGGATGG - Intergenic
921322202 1:213952895-213952917 AGGTTCAAGAACACAGAGAAAGG + Intergenic
921881234 1:220256637-220256659 AGATTTAAAAAGACAAAGAAGGG + Intronic
922137875 1:222850331-222850353 GGGTTTAAAAAGAGAGAACAAGG - Intergenic
922572194 1:226640764-226640786 TGGTTTCAAAAGACAAAGAAGGG + Intronic
923221638 1:231899853-231899875 GGGTATAAAATAACATAGAATGG - Intronic
923262487 1:232280804-232280826 GAGTTTGAAAAGAAAGAGAAAGG + Intergenic
923588229 1:235295090-235295112 GGATGTAAATAGACAGACAAAGG + Intronic
923729867 1:236539786-236539808 GGGCTCAAAAGGCCAGAGAAGGG - Intronic
924126928 1:240864526-240864548 AGGTTGATAAAGACAAAGAAAGG + Intronic
924240729 1:242037745-242037767 GGAATACAAAAGACAGAGAAGGG - Intergenic
924273187 1:242356318-242356340 TATTTTAAAAAGACAAAGAAGGG - Intronic
924369763 1:243335253-243335275 GGGTTTAGAAACGCAGAGTATGG + Intronic
924594526 1:245433860-245433882 GGGTTTAAAAGGACAAACCATGG - Intronic
924862994 1:247945752-247945774 AGGTCAAAAAAGACAAAGAAGGG - Intronic
924872002 1:248057392-248057414 AGGTCAAAAAAGACAAAGAAGGG - Intronic
924952695 1:248898988-248899010 GAGATTAAAAACACAAAGAAGGG + Intergenic
1063011014 10:2021489-2021511 GGGCGTAGAAAGACAGAGACAGG - Intergenic
1063741413 10:8825595-8825617 GTGTAGAAAAAGACTGAGAAGGG + Intergenic
1064248026 10:13684729-13684751 TGATTTCAGAAGACAGAGAAGGG + Intronic
1064328046 10:14369056-14369078 GGGTTTAAATTGAGACAGAATGG - Intronic
1064508966 10:16068036-16068058 GAATTTAAAAAGACTGAGTAAGG + Intergenic
1065371680 10:24993148-24993170 GTTTTTAAAAAGAAAGGGAATGG + Intronic
1065689807 10:28321534-28321556 GGATTTAGAATGACAGTGAAGGG - Intronic
1065713815 10:28544761-28544783 AGGGTTAAAAAAACAGAAAACGG + Intronic
1065907882 10:30274520-30274542 AGATCAAAAAAGACAGAGAAGGG + Intergenic
1066711534 10:38240331-38240353 TATTTTAAAAAGACAAAGAAGGG + Intergenic
1067056350 10:43054615-43054637 AGTTTTAAAAATAAAGAGAAAGG + Intergenic
1068027297 10:51662293-51662315 GGGCATAAAAAGACAGAAACTGG + Intronic
1068053341 10:51980738-51980760 TAATTTAAAAAGACAAAGAAGGG - Intronic
1068300996 10:55138876-55138898 GGGTTTAAAAAAATATACAAAGG - Intronic
1068528428 10:58157784-58157806 GAGTTTAAAACCACAGACAATGG - Intergenic
1068582243 10:58754822-58754844 TGGTTTGAGAAGACAGAGGAAGG + Intronic
1069359015 10:67620992-67621014 GAGGTTAAAAAGGCATAGAAGGG + Intronic
1069481941 10:68790997-68791019 GGGTCTAAAAATGCAGTGAATGG - Intronic
1069837817 10:71319999-71320021 GGATTAAAAAATAAAGAGAAAGG - Intronic
1069984919 10:72276472-72276494 GGATTTAAAAAGACTAAGAGGGG + Intergenic
1070383271 10:75900785-75900807 TTGTTTAAAAAGAAAAAGAAAGG - Intronic
1071134322 10:82436294-82436316 AAGATAAAAAAGACAGAGAAGGG - Intronic
1071803415 10:89089989-89090011 GAGTTAAAAAAGAGAGAGACAGG - Intergenic
1071865546 10:89726500-89726522 GAGTTAAAAAAGAGAGAAAATGG + Exonic
1072761504 10:98060670-98060692 GGGTTTTAAAAGATGGAGAGAGG + Intergenic
1073151989 10:101318244-101318266 GGGTTTAAAATGTCAGAACAGGG - Intergenic
1073282800 10:102367030-102367052 GGGTTTAATTGGCCAGAGAAGGG + Intronic
1074514834 10:114156834-114156856 GTTTTTAAAAATACTGAGAATGG + Intronic
1075157940 10:119995484-119995506 CAGTTTAAAAAGACAAAGAGGGG - Intergenic
1077548216 11:3186093-3186115 TGTTTTAAAAAGACAAGGAAAGG - Intergenic
1078867748 11:15313508-15313530 AGGGAGAAAAAGACAGAGAAGGG - Intergenic
1079660131 11:23027631-23027653 GATTTTTAAAAGATAGAGAAGGG - Intergenic
1079956909 11:26877559-26877581 TGATTTAAAAAGGCAAAGAAGGG + Intergenic
1080117221 11:28634453-28634475 GGATTTAAAAAGAAAAAGAAAGG - Intergenic
1080612395 11:33915794-33915816 GCGATAAAAAAGATAGAGAATGG - Intergenic
1081079978 11:38729883-38729905 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1082106283 11:48225272-48225294 GGGTTTAAAAAGTCAAGGATCGG + Intergenic
1082876040 11:57990182-57990204 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1082994180 11:59235958-59235980 AGGTCAAAAAAGACACAGAAGGG + Intergenic
1084969591 11:72763736-72763758 GGGTTGAAGAAGACAGAGGCCGG + Intronic
1085370562 11:76000095-76000117 GCATTTAAAAAGAGAGAGAAAGG + Intronic
1085850323 11:80111728-80111750 GGATCAAAAAAGACAAAGAAGGG + Intergenic
1085964690 11:81508673-81508695 GGGTTGAAAAAGAAAGTGTAAGG - Intergenic
1086132578 11:83416742-83416764 AGATCAAAAAAGACAGAGAAGGG - Intergenic
1086351543 11:85946892-85946914 AGGTGTAAAGAGACAGAGTATGG + Intergenic
1086395976 11:86415366-86415388 GGGTGGAAAAAGAGAGATAAAGG - Intronic
1086741692 11:90377466-90377488 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1086819178 11:91413692-91413714 CAGTTAAAAAAGACAGAGAGGGG - Intergenic
1086865668 11:91976877-91976899 GGCTTTAAAAAGAGAAAGATGGG - Intergenic
1087408621 11:97762398-97762420 GGGTTTACAGAGAAAGAGTATGG + Intergenic
1087437068 11:98134644-98134666 TGGCTGAAAAAGACAGGGAAAGG - Intergenic
1087515271 11:99152399-99152421 TGGTCAAAAAAGACAAAGAAGGG - Intronic
1087826415 11:102769241-102769263 AGGTTAAAAATGACAGGGAAGGG - Intergenic
1087833272 11:102843365-102843387 GGGTTTTAAGACACACAGAATGG + Intronic
1087857682 11:103111257-103111279 GGGTTTACAAAGATATAAAAAGG + Intronic
1087987473 11:104701861-104701883 GGCTTGAAAGAGACAGAGATAGG - Intergenic
1088752955 11:112860217-112860239 AGGTTAACAAAGCCAGAGAAAGG - Intergenic
1088890761 11:114042378-114042400 TGGTCTAGACAGACAGAGAAGGG + Intergenic
1089199474 11:116715152-116715174 GGGTGAGAGAAGACAGAGAAAGG + Intergenic
1089285228 11:117402925-117402947 AGATTAAAAAAGACAAAGAAGGG - Intronic
1089539562 11:119181770-119181792 GGGGTGAAAAAGGCAGAAAAAGG + Intronic
1090098564 11:123769202-123769224 TGTTTTAAGAAGAGAGAGAAGGG - Intergenic
1090535910 11:127641447-127641469 TGGGTTAAAATGAGAGAGAAAGG + Intergenic
1091553204 12:1552508-1552530 GGGGTGAAAAGGACGGAGAATGG - Intronic
1092442937 12:8525453-8525475 AGGTTAAAAAAGACAAAGAATGG - Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1093000260 12:13988372-13988394 GCCTTTAAAAAATCAGAGAAAGG - Intergenic
1093201860 12:16197416-16197438 GGGTATAAAAAGATATAGAAAGG + Intronic
1093225473 12:16478327-16478349 GGCTCTAAAAACACAGAGAAAGG - Intronic
1093874832 12:24338057-24338079 GTGTTTCAAAAACCAGAGAAAGG - Intergenic
1094206873 12:27849884-27849906 AGGTAAAAAAAGACAAAGAAGGG - Intergenic
1094397064 12:30019039-30019061 TGTTTTAAGAAGACAGAAAAAGG + Intergenic
1094825070 12:34263608-34263630 GGATTAAAAAAGAAAGAAAAAGG - Intergenic
1095488747 12:42710564-42710586 AGATCTAAAAAGACATAGAAGGG + Intergenic
1095790982 12:46166807-46166829 GGGTTTAAGAAGAGAGAAGAAGG + Intergenic
1095979989 12:47967006-47967028 GGGTTTGAAAAAACAGAAAGTGG + Intronic
1096188424 12:49599134-49599156 GGGATGAAACAGAAAGAGAAAGG + Intronic
1097226208 12:57478015-57478037 AGGTAAAAGAAGACAGAGAAGGG + Intronic
1097352226 12:58561321-58561343 GGGCTTAAAACAACAGAGACTGG - Intronic
1097482446 12:60146969-60146991 GGTTTTTCAAAGACAGAAAATGG - Intergenic
1097499665 12:60387399-60387421 TGGGTTAAAAAAACAGAAAAGGG + Intergenic
1097619747 12:61924971-61924993 AGGTCAAAAAAGACAAAGAAGGG + Intronic
1098360129 12:69646498-69646520 TGGTTGAAAAAGCCAGTGAATGG + Intronic
1098493455 12:71108786-71108808 GGAATAAAAAAGACAGAGAAGGG - Intronic
1098661627 12:73101514-73101536 TGGATTAAAGAGAGAGAGAAAGG - Intergenic
1098746740 12:74246597-74246619 TAGTTTCAAAAGGCAGAGAAGGG - Intergenic
1098835113 12:75415111-75415133 GAGTTTAACATGTCAGAGAAAGG + Intronic
1098878616 12:75892940-75892962 GGGTTTATAAAGGAAGAGAAGGG - Intergenic
1099423263 12:82490947-82490969 GGGTTAAAAAAGAAATAAAAGGG + Intergenic
1099924717 12:89003382-89003404 GAATTTAAAAAGAAAGAAAAAGG - Intergenic
1100115329 12:91296586-91296608 AGATTTAAAAAGACAAAGAAGGG + Intergenic
1100203385 12:92323476-92323498 TGGTTAAAAAAGACAAAGAGGGG - Intergenic
1100220331 12:92497918-92497940 GGAGTTAAAAAGAGAGAGAAAGG + Intergenic
1100865883 12:98856292-98856314 GGGTTCAAAAATAAGGAGAATGG - Intronic
1101542581 12:105678349-105678371 GGGCTTAAAGAGAGAGAGTATGG - Intergenic
1101783630 12:107862215-107862237 AGATCAAAAAAGACAGAGAAGGG + Intergenic
1101867232 12:108529142-108529164 AATTTTAAAAAGAGAGAGAAGGG + Intronic
1102249496 12:111376581-111376603 CTGTTTAAAAAGAGAGAGAGAGG + Intergenic
1102572591 12:113836106-113836128 GAGTTTGAAAAGAGAGAGCAAGG - Intronic
1102675470 12:114655339-114655361 GGCTTTGAAAAGAGTGAGAAAGG - Intergenic
1102866651 12:116380141-116380163 GGGATTAAAAAGAAAGAAATGGG - Intergenic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1105245190 13:18643826-18643848 GGATGTAAAGAGACAGTGAAAGG + Intergenic
1106753538 13:32798529-32798551 GGGTTTGAAGTGACAGGGAAGGG - Intergenic
1107048387 13:36019778-36019800 GAGTTTTAAAAGACAGCGAAAGG + Intronic
1107550200 13:41466990-41467012 GGGATAAAAGGGACAGAGAAGGG - Intronic
1107776871 13:43853375-43853397 AGATTTAAAAAGAAAAAGAAGGG + Intronic
1108817540 13:54310273-54310295 GAATTTTAAAAAACAGAGAAGGG - Intergenic
1108940800 13:55950023-55950045 AGATTAAAAAAGACAAAGAAGGG + Intergenic
1109112780 13:58344371-58344393 AGGACTCAAAAGACAGAGAAAGG + Intergenic
1109170461 13:59090127-59090149 AGGTTGAGAAAGACAAAGAAAGG - Intergenic
1109626413 13:64980858-64980880 GGATCAAAAAAGACAAAGAAGGG - Intergenic
1109746947 13:66636964-66636986 GGGTTAAAAAATATAGAGACTGG + Intronic
1109958312 13:69598726-69598748 AGTTTTAAAAAGGCAGAAAAGGG - Intergenic
1110858111 13:80319140-80319162 AGGTTTTAAAAGACAGGGATGGG - Intergenic
1111101730 13:83597054-83597076 AGGTGAAAAAAGACAAAGAAGGG - Intergenic
1111726055 13:92010668-92010690 GGGTGGAGAGAGACAGAGAAAGG - Intronic
1112381965 13:98899876-98899898 GGTTTTAAAAAGAAAAAGAAGGG - Intronic
1112701494 13:102014629-102014651 GAATTTAAAAAGACATATAATGG + Intronic
1112711636 13:102136137-102136159 AGGTGTAAAATGACATAGAATGG - Intronic
1113048615 13:106183887-106183909 GGGTGTGAAAATACACAGAATGG - Intergenic
1113211928 13:107993493-107993515 GGGTTAAAAATGCAAGAGAATGG + Intergenic
1113573289 13:111373967-111373989 TTGTTTAAAAAAACAGGGAACGG - Intergenic
1113584303 13:111452943-111452965 AGGTTTAAAAGGATGGAGAATGG - Intergenic
1114130509 14:19786367-19786389 ATGTTTAAAAAAACAAAGAAAGG + Intronic
1114397888 14:22383575-22383597 GGGTTTGCAAAGAAAGAAAAAGG - Intergenic
1114760054 14:25303735-25303757 GGATCAAAAAAGACAAAGAAGGG + Intergenic
1114778120 14:25509407-25509429 GGGGTGAGAAAGACAGTGAAGGG - Intergenic
1114817899 14:25981557-25981579 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1115148070 14:30249866-30249888 GGTCTTAGAAAGAAAGAGAAGGG + Intergenic
1115295197 14:31818053-31818075 AGATTTAAAAAGACAAAGAAGGG + Intronic
1115385689 14:32793740-32793762 CGATTAAAAAAGACAAAGAAGGG + Intronic
1115453022 14:33570559-33570581 GGGTTTGCAAAGACCAAGAAAGG + Intronic
1116095106 14:40357614-40357636 GTGTTTAAAAGGACAGACAGTGG + Intergenic
1117043094 14:51785809-51785831 AAGTTTAAAAAGAAAGAAAACGG - Intergenic
1117602252 14:57388591-57388613 GCTTTTTAAAAGACAGAAAAGGG + Intergenic
1118149623 14:63175878-63175900 AGGTTTAAAAAGACAGATGCTGG - Intergenic
1119456483 14:74760365-74760387 GGGTATAAAAAGAAAGGAAAAGG - Intergenic
1120116897 14:80629018-80629040 GAGTTTAAAAAGGGAGAGTAAGG - Intronic
1120353341 14:83393304-83393326 TTGTTTAAAAAGAGAGAAAAGGG + Intergenic
1120409206 14:84130816-84130838 GGATTTGAAAAGACACATAAGGG - Intergenic
1121475831 14:94201571-94201593 CAGTTTAAAAAGACAAAGAGGGG - Intronic
1122744329 14:103889127-103889149 GGGTTTAAAAAAAAAAAAAAAGG - Intergenic
1123163742 14:106306005-106306027 GTGTATGTAAAGACAGAGAAGGG + Intergenic
1123874499 15:24609985-24610007 GGGGTTAGAATGACAGAGAAAGG - Intergenic
1123901441 15:24881219-24881241 TGGTTTAAAAAGTCACAGTAAGG + Intronic
1124711777 15:32018917-32018939 ATATTTAAAAAGAAAGAGAAAGG - Intergenic
1126173098 15:45710642-45710664 AGGTTATAAAAGACAAAGAAAGG - Intergenic
1126174884 15:45726877-45726899 GTGTCAAAAAAGACAAAGAAAGG - Intergenic
1126564835 15:50084334-50084356 GGCTTTAAAAAGAGATACAAGGG + Intronic
1126784529 15:52166076-52166098 AGATAAAAAAAGACAGAGAAGGG + Intronic
1127255016 15:57282607-57282629 GGGTTTGAAAAGAAACAGCAAGG + Intronic
1127368025 15:58309635-58309657 GGGCTCAAAAAGACAGATAAAGG - Intronic
1127966258 15:63924923-63924945 AGGTCTAAAAAGAGTGAGAACGG - Intronic
1128779596 15:70350381-70350403 GGATTTAGAAACACAGAGAATGG - Intergenic
1128856918 15:71025767-71025789 AGATCAAAAAAGACAGAGAAGGG + Intronic
1128857264 15:71029777-71029799 AGGTCAAAAAAGACAGAGAAGGG - Intronic
1130180811 15:81626182-81626204 AAGTTTAAAAACACAGAGATAGG + Intergenic
1130430405 15:83841818-83841840 GGGTTTTTATAGACACAGAATGG - Intronic
1130724263 15:86421835-86421857 AGATTTAAAAAGACAAAGAAGGG + Intronic
1131519634 15:93103934-93103956 CAGTTTAAAATGACAGAGCAAGG - Intergenic
1131698138 15:94902670-94902692 GAGTGAAAGAAGACAGAGAAGGG + Intergenic
1131996248 15:98135601-98135623 GGCTTTGAAAAAACAGAGAAGGG + Intergenic
1132245043 15:100288256-100288278 TTTTTTAAAAAGACAAAGAAGGG + Intronic
1132484547 16:183746-183768 GGCTTTGAAAAGGCAGAGTATGG - Intergenic
1132866588 16:2095905-2095927 GGTTTTAAAAATACAGAGTATGG - Intronic
1132918413 16:2368093-2368115 GTGTTTAAAAAGATAGAATAGGG - Intergenic
1133560371 16:6945063-6945085 GGGTTTGTGAAGACAGAGCAGGG + Intronic
1133620856 16:7524945-7524967 GGGTTTAAAAAGCCAGACATTGG + Intronic
1134095233 16:11414503-11414525 GGGTCTCTAGAGACAGAGAATGG + Exonic
1134429679 16:14191644-14191666 CTGTTTAAGAAGGCAGAGAAGGG - Intronic
1135044793 16:19146378-19146400 GGATTTAAAGAAAAAGAGAATGG + Intronic
1135873971 16:26179965-26179987 GTGTCAAAAAAGACAAAGAAAGG + Intergenic
1136385342 16:29922458-29922480 GGGTTCCGAAAGACAGGGAAGGG - Intronic
1137448159 16:48545258-48545280 AGGTTTAAAAAGACAAAGCCGGG - Intronic
1137527985 16:49253609-49253631 GGGTAAAAAATGACAGAAAAAGG + Intergenic
1137662893 16:50224862-50224884 GTGTTTAAAAAGAAAGGGAGAGG - Intronic
1138046773 16:53733029-53733051 AAATTTAAAAAGACAGAAAAGGG - Intronic
1138047350 16:53739126-53739148 AAGATTAAAAAGACAGACAAGGG - Intronic
1138478112 16:57284010-57284032 GGGGTGAAAAAGAGAGAGGAGGG + Intronic
1139056955 16:63197157-63197179 AAGATAAAAAAGACAGAGAAGGG - Intergenic
1140127771 16:72132377-72132399 GGGAATAAAAAGCCAGGGAAGGG + Intronic
1140182459 16:72734277-72734299 TTTTTTAAAAAGACAAAGAAGGG - Intergenic
1140441088 16:74988459-74988481 GGGTTTCTAAAGAAAAAGAAGGG - Intronic
1140771032 16:78204220-78204242 GGGTTTAAAAGAACAAAAAAAGG - Intronic
1141081016 16:81052543-81052565 ATTTTTAAAAAGAAAGAGAAGGG + Intergenic
1142895396 17:2974038-2974060 GTGTTTAAAAAAAGAAAGAAGGG + Intronic
1143232766 17:5371378-5371400 GGGGTGAAAAGGACAGGGAATGG - Intronic
1143554297 17:7651115-7651137 GGGTACAAAAAGGCAGAGAGAGG - Exonic
1143693951 17:8596451-8596473 GGCTTTAAAAAGTCAGAAAATGG - Intronic
1144678545 17:17177224-17177246 GGGAGTGAAATGACAGAGAATGG - Intronic
1145772779 17:27505365-27505387 GGGTTAATGAGGACAGAGAAGGG - Intronic
1146010882 17:29193525-29193547 GGCTTTAAAAGGTCAGAGATTGG + Intergenic
1146082492 17:29793550-29793572 TGGTTTAAAAAGAGGCAGAAAGG - Intronic
1146824328 17:36009910-36009932 GGGGACAAAAAGACAGAAAACGG + Intergenic
1147235572 17:39055056-39055078 GGGTTTTTAAAGACTGGGAAGGG + Intergenic
1147301713 17:39534407-39534429 GGGTCAAAAACGAGAGAGAAAGG - Exonic
1147477134 17:40722994-40723016 AGATTTAAAAAGAGAGAGAGAGG - Intergenic
1147644551 17:42026019-42026041 GGGTTCAGGAAGTCAGAGAAAGG + Intronic
1148155371 17:45421863-45421885 GGGTTTAAAAATACAGTGATAGG + Intronic
1148527132 17:48350184-48350206 AAATTTAAAAAGACAGAAAATGG + Intronic
1149141251 17:53435817-53435839 GAGTTTCAAAAGTCAGAGGAAGG + Intergenic
1149145480 17:53486836-53486858 CGGTTTAAAAGGTAAGAGAAAGG - Intergenic
1149241933 17:54661277-54661299 AGATTTAAAAAGACAAAGAAAGG - Intergenic
1149584396 17:57775745-57775767 ATATTTAAAAAGATAGAGAAGGG - Intergenic
1149952377 17:61003455-61003477 CGATTTAAAAAGGCAAAGAAAGG - Intronic
1150383218 17:64737311-64737333 TGGTTTAGAAAGACAGAAAGTGG - Intergenic
1150387058 17:64770507-64770529 GGGTTTAAAAATACAGTGATAGG + Intergenic
1150608134 17:66712024-66712046 GGGTTTTCAAACACAGACAAGGG - Intronic
1150872682 17:68930981-68931003 GGGTTTAAAATGTCAGAGGTTGG - Intronic
1150917646 17:69452613-69452635 CTGTTTAAAAACACAGAGATAGG + Intronic
1151091702 17:71447242-71447264 GGGGTGAAAAAGAGAGGGAAGGG - Intergenic
1151266700 17:72962143-72962165 GGCTTAGAAAAGAGAGAGAAGGG - Intronic
1151363481 17:73602606-73602628 GGGATTTAAGAGACTGAGAATGG - Intronic
1151528571 17:74688631-74688653 GAGTGTAAAAAAAAAGAGAACGG + Intronic
1152064975 17:78106474-78106496 GGGTTTAAAAATACATGAAATGG - Exonic
1153173379 18:2342278-2342300 GGGTTGAAAAAGAAATAAAATGG + Intergenic
1154936580 18:21064187-21064209 TGGTTTATAATGAGAGAGAAAGG - Intronic
1155253802 18:23977120-23977142 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1155615288 18:27715145-27715167 GTGTTTAAAAAGCAAGAGAATGG + Intergenic
1156700716 18:39821091-39821113 GGGTAGACAAAGAGAGAGAAGGG + Intergenic
1157703083 18:49777294-49777316 AAGTTTAAAAAGACAAAGAGGGG - Intergenic
1158356750 18:56629595-56629617 GGGGGTAAAAAGACAGAGACAGG + Intronic
1158659104 18:59369744-59369766 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1158673466 18:59497828-59497850 CAGGTTAAAAAGACAGAGAGGGG + Intronic
1158683650 18:59592902-59592924 GGGTTTAAAAATAAAAAAAAAGG + Intronic
1158834872 18:61320435-61320457 GTGTGAAAAAAGACAGATAAAGG + Intergenic
1159076897 18:63690452-63690474 AGGTCAAAAAAGACAAAGAAGGG + Intronic
1159644981 18:70907290-70907312 GGCTTGAAAATGCCAGAGAATGG - Intergenic
1159808903 18:72992554-72992576 GAATTTTAAAAGAGAGAGAAAGG - Intergenic
1162146550 19:8615783-8615805 TGGTTTAAATAAAAAGAGAATGG - Intergenic
1164163630 19:22648701-22648723 GATTTAAAAAAGACAAAGAAGGG - Intronic
1165592272 19:36979281-36979303 AGTTTTAAAAAGACAGTTAAAGG - Intronic
1165858800 19:38895770-38895792 CTATTTAAAAAGAGAGAGAAAGG + Intronic
1166559291 19:43721023-43721045 GTGCTTGAGAAGACAGAGAATGG + Intergenic
1166904538 19:46098258-46098280 GGTTCAAAAAAGACAAAGAAGGG - Intergenic
1167268583 19:48495445-48495467 GGGTGAAAAGAGGCAGAGAATGG - Intronic
1168440144 19:56357998-56358020 AGGTCAAAAAAGACAAAGAAGGG + Intronic
927390710 2:22591663-22591685 AGATTTAAAAAGACAAAGAAGGG + Intergenic
927725680 2:25420781-25420803 AGGTTCTAAAAGACAGAGACCGG - Intronic
928338169 2:30416902-30416924 GGGGTTAGCAAGACAGAGATGGG - Intergenic
928850252 2:35736519-35736541 TTTTTTAAAAAGACAAAGAAGGG + Intergenic
928906205 2:36370723-36370745 GGAGCTAAAAAGAGAGAGAAGGG + Intronic
929593260 2:43160418-43160440 GGGTGTGAAAAGACAGGGAGGGG - Intergenic
929859394 2:45663451-45663473 GGATCTAAATAGACAGGGAAAGG + Intronic
930175819 2:48300749-48300771 AGATTAAAAAAGACAAAGAAGGG - Intergenic
930229668 2:48830191-48830213 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
930586198 2:53269697-53269719 AGATGAAAAAAGACAGAGAAGGG + Intergenic
930916182 2:56691195-56691217 AGATTAAAAAAGACAAAGAAGGG + Intergenic
930924749 2:56803448-56803470 CAGTTTAAACAGACAGAGATAGG + Intergenic
930939257 2:56995064-56995086 AGATTTAAAAAGACAAATAAGGG - Intergenic
931083993 2:58808445-58808467 GGGTTGGAACATACAGAGAAAGG - Intergenic
931412947 2:62052148-62052170 GGCTTTAAAAAGATAGAAATTGG + Intronic
931488878 2:62723237-62723259 AGATTAAAAAAGACAAAGAAGGG - Intronic
931505315 2:62920031-62920053 GGAGTGGAAAAGACAGAGAAAGG + Intronic
931571811 2:63676661-63676683 GGGTTAGAAAAGAAAGAGGATGG + Intronic
931918078 2:66980797-66980819 CTTTTTAAAATGACAGAGAAAGG + Intergenic
932307767 2:70716022-70716044 GGCTTTAAAAAGAAAAAAAAAGG - Intronic
932753198 2:74385608-74385630 GGGTTTAAAAAGAGAAAGGATGG - Intronic
933044024 2:77510952-77510974 GTGTTTAAAAAGAAACAAAATGG + Intronic
933695028 2:85211378-85211400 TGGTTTAAAAAGAAAGAGCTGGG + Intronic
934863420 2:97783791-97783813 GTAATTAAAAAGACAGAGATTGG + Intronic
935478718 2:103558732-103558754 TGATATAAAAAGACAAAGAAAGG + Intergenic
935799338 2:106677817-106677839 AGATTAAAAAAGACAAAGAAGGG - Intergenic
936339771 2:111620878-111620900 GAGATGAAAAAGAGAGAGAAAGG + Intergenic
937679552 2:124628948-124628970 AGGTAAAAAAAGACAAAGAAGGG + Intronic
938815362 2:134898085-134898107 TTATTTAAAAAGAGAGAGAATGG + Intronic
939211682 2:139183611-139183633 CTGTCTAAAAAGACAGAGAGAGG - Intergenic
939458054 2:142463500-142463522 TGGTTAGAAAAGACAAAGAAAGG - Intergenic
939623136 2:144445461-144445483 GGGTTTTCAAAGAGAGAGAGAGG - Intronic
939833988 2:147105713-147105735 ATTTTTAAAAAGAGAGAGAAAGG - Intergenic
939937516 2:148311405-148311427 AGGTAAAAAAAGACAAAGAAGGG - Intronic
940041878 2:149369668-149369690 GGGTCAAAAAAGCCAGACAAAGG + Intronic
940084017 2:149837863-149837885 GGATCAAAAAAGACAAAGAAGGG - Intergenic
940201858 2:151160513-151160535 GGCTTTAAAAAGGCAGCAAAGGG + Intergenic
940375826 2:152957517-152957539 AGTTTTAAGAAGAGAGAGAATGG - Intergenic
940629291 2:156217570-156217592 GGATCAAAAAAGACAAAGAAGGG + Intergenic
940920801 2:159304290-159304312 AGATTAAAAAAGACAAAGAAGGG + Intergenic
941016265 2:160360611-160360633 ATGTTTAAAAAGGCACAGAAAGG - Intronic
941024425 2:160442875-160442897 GGGTTTAAAAAGAAACAAGAAGG - Intronic
941276833 2:163500048-163500070 AGATTAAAAAAGACAAAGAAGGG + Intergenic
941426493 2:165352178-165352200 TGGATTAAAAAAACAGACAAAGG - Intronic
941605418 2:167590880-167590902 GGGTATAAAGTAACAGAGAATGG + Intergenic
942121516 2:172782489-172782511 GGGTTGAAAGAGTTAGAGAAGGG - Intronic
942152811 2:173094581-173094603 ACGTCTTAAAAGACAGAGAAAGG - Intronic
942899010 2:181091598-181091620 AGATTTAAAAAGACAAAGAAGGG + Intergenic
943087072 2:183325046-183325068 AGATCTAAAAAGACAAAGAAGGG + Intergenic
943158777 2:184219324-184219346 AGGTCAAAAAAGACAAAGAAGGG - Intergenic
943414251 2:187579569-187579591 GGATTTAAAAAAACAGCAAAGGG + Intergenic
943586389 2:189745750-189745772 GAATTTAAAAAGACAGTAAAAGG + Intronic
944275367 2:197831404-197831426 GGATCAAAAAAGACAAAGAAGGG + Intronic
944287683 2:197970243-197970265 GTGTGTAAAAAGAGAGAGCATGG + Intronic
944363949 2:198894050-198894072 AAATTTAAGAAGACAGAGAAGGG + Intergenic
944837848 2:203597571-203597593 GGGTTTGAAAATGCAGAGACTGG + Intergenic
944918259 2:204383525-204383547 AGATCAAAAAAGACAGAGAAGGG - Intergenic
944921985 2:204424186-204424208 ATTTTTAAAAAGACAAAGAAGGG + Intergenic
945151052 2:206792421-206792443 GGGGGAAAAAAGAAAGAGAAAGG - Exonic
945366505 2:208961038-208961060 GATTTCAAAAAGACAAAGAAGGG + Intergenic
945724383 2:213457577-213457599 GGGTTTTAAAAAAAAGAAAAGGG - Intronic
946574819 2:221063569-221063591 GGGTTTAGACAGACATATAATGG + Intergenic
946881508 2:224181529-224181551 GGCTTTAAGGACACAGAGAAGGG + Intergenic
946978382 2:225178343-225178365 GGGTTTAATAAGAGCTAGAATGG + Intergenic
947976548 2:234371415-234371437 TTTTTTAAAAAGACAGAAAAGGG + Intergenic
948343367 2:237273563-237273585 GGATCAAAAAAGACAAAGAAGGG + Intergenic
1168783376 20:514385-514407 GGATGTGAAAAGACAGAAAAGGG + Intronic
1169649300 20:7849213-7849235 GGGGTCACAAAGAGAGAGAAAGG + Intergenic
1169978959 20:11362302-11362324 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1170005619 20:11665652-11665674 AGGTTTGAAAAGAAAGATAAAGG - Intergenic
1170317849 20:15061860-15061882 GGGCTTAGAAAGAGAGAGACAGG - Intronic
1172846663 20:37933727-37933749 GGCTTTTAAAAAACAGAGCAAGG - Intronic
1173776967 20:45716711-45716733 GACTTTAAAAAGACAAAAAAGGG + Intergenic
1174475025 20:50790564-50790586 GACTTTAAAAAGACACAGACAGG + Intergenic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1175155931 20:56971560-56971582 GGGCTTAAAAGGGCAGAGAGGGG + Intergenic
1176452330 21:6875119-6875141 GGATGTAAAGAGACAGTGAAAGG + Intergenic
1176830502 21:13740168-13740190 GGATGTAAAGAGACAGTGAAAGG + Intergenic
1176977689 21:15341239-15341261 GGCTGTCAAAAGAAAGAGAAAGG - Intergenic
1177042446 21:16130955-16130977 GAGATCAAAAAGACAAAGAAGGG - Intergenic
1177829166 21:26117559-26117581 GGGGTTATAGGGACAGAGAAGGG + Intronic
1178033703 21:28557040-28557062 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1178120652 21:29466851-29466873 AGGGTTAAGAAGAAAGAGAAAGG - Intronic
1178183855 21:30196705-30196727 GGGTTTAAAAAGATAAATGATGG - Intergenic
1178539846 21:33440155-33440177 GGTTTTACAAAAACAGGGAATGG - Intronic
1179118934 21:38524707-38524729 GGGGTGAAAAAGACAGAAAGTGG + Intronic
1179142002 21:38733864-38733886 GGGTTTAAAAATACTGAGGCTGG - Intergenic
1179610855 21:42548885-42548907 AGGTATGAAAAGACAGAAAAAGG - Intronic
1179965959 21:44805798-44805820 GACTGTAAAAAGGCAGAGAATGG + Exonic
1180115007 21:45696965-45696987 GGTGTGAAAAAGACAGAAAATGG + Intronic
1180196288 21:46196341-46196363 GGGTCTCAAAAGAATGAGAATGG + Intronic
1180969774 22:19809140-19809162 GGGTTTTTAAAGGCACAGAATGG - Intronic
1181360774 22:22332888-22332910 GGATCAAAAAAGACAAAGAAAGG + Intergenic
1182226693 22:28804292-28804314 GGCATTAAAAGGACAAAGAAGGG + Intergenic
1182915073 22:34021936-34021958 GCTTTTAAAAAGAGAGAGCAAGG - Intergenic
1183087807 22:35497723-35497745 GGGTTTCAAAAGCTAGAAAATGG + Intergenic
1183148645 22:36018960-36018982 GGGTTTGAAGAGACTGAAAAGGG + Intronic
1183232614 22:36592365-36592387 GGGATGCAAAAGACAGAGAGTGG + Intronic
1183421399 22:37713623-37713645 GGCTGTGAAAAGACAGGGAAAGG + Intronic
1183846605 22:40546391-40546413 GAGTTTAAAAAGCCGGAAAAAGG + Intronic
1185418726 22:50723352-50723374 AGCTTTAAAAAGGCAGACAAGGG - Intergenic
949499406 3:4664876-4664898 GCGTTTAAGAACACAGACAATGG - Intronic
949552810 3:5125312-5125334 GGCTTGAAAAATACTGAGAAGGG + Intronic
949668853 3:6374926-6374948 GGCTTTACAATGACACAGAATGG - Intergenic
949725513 3:7040286-7040308 GAGTTTACAGAGACAGACAAGGG - Intronic
950779108 3:15375758-15375780 GGCTTTAAAAAGTCAGATATCGG - Intergenic
951005523 3:17611377-17611399 GAGTTTAAAAGAAGAGAGAATGG + Intronic
951921147 3:27855160-27855182 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
952651514 3:35733037-35733059 TTATTTAAAAAGAGAGAGAAGGG - Intronic
953138423 3:40204634-40204656 GGGTTTAAATGGAAAGAAAAAGG - Intronic
953364792 3:42334831-42334853 GGGATTGCAAAGACAGAGAGAGG - Intergenic
953661962 3:44897979-44898001 AGATTTAAAAAGGCAGAGGACGG + Intronic
953816322 3:46161041-46161063 AGATTTAAAAAGACAAAGAAGGG - Intergenic
954495274 3:50953036-50953058 GGGATTAGAAAGTCAGAGAATGG - Intronic
954593493 3:51804446-51804468 AGGTTTAAAAAGTCATAAAATGG - Intergenic
954697462 3:52435394-52435416 GGGTCTAAGAGCACAGAGAAGGG + Exonic
954957328 3:54533120-54533142 GGGTTTAGACAGACAGGAAAAGG - Intronic
955073907 3:55594840-55594862 GTTTTGAAAAAGACTGAGAAAGG - Intronic
955225815 3:57059694-57059716 GGCTTTAAAAAGACGAAGAGGGG + Intronic
955644461 3:61121965-61121987 AGATTAAAAAAGACAAAGAAGGG + Intronic
956065909 3:65397016-65397038 GGGCTCCAAAAGGCAGAGAAGGG + Intronic
956090228 3:65658705-65658727 TGGATTAAAAAGAGAGAGAGAGG - Intronic
956100377 3:65761945-65761967 GGGCTTAAATAGACACAAAATGG + Intronic
956299545 3:67755436-67755458 TGATTAAAAAAGAAAGAGAAAGG + Intergenic
956372089 3:68573627-68573649 AGGTCGAAAAAGACAAAGAAGGG + Intergenic
956936336 3:74106093-74106115 GGTTTTAAAACAACTGAGAATGG - Intergenic
957485040 3:80849978-80850000 CTGTGTGAAAAGACAGAGAAGGG + Intergenic
958131361 3:89429288-89429310 GAGGCTAAATAGACAGAGAAGGG + Intronic
958487398 3:94730139-94730161 GGGTTCAAATTGACAAAGAATGG - Intergenic
958515613 3:95111572-95111594 AGGTCAAAAAAGACAAAGAAGGG - Intergenic
958548069 3:95581849-95581871 GGGTTCAGAGAGACAGAGAGGGG + Intergenic
958633148 3:96707012-96707034 GGGTTTAAAAAAAAAGAAAGAGG + Intergenic
959291242 3:104476858-104476880 CGATTTAAAAAGACAAAGAAGGG + Intergenic
959458171 3:106589921-106589943 GGGTTTAAAAGGGGAGAGAGTGG - Intergenic
959629673 3:108493725-108493747 GAATTTAGAAAGTCAGAGAAAGG + Intronic
959957484 3:112254969-112254991 GTTTTTAAAAACACAAAGAAGGG + Intronic
960012811 3:112851668-112851690 AGATTTAAAAAGGCAAAGAAGGG + Intergenic
960118689 3:113925025-113925047 TGATTTAAAAAGACAAATAAGGG - Intronic
960186746 3:114651117-114651139 GTGTTTAAAAAGAACAAGAAAGG + Intronic
960580067 3:119269575-119269597 GGATCAAAAAAGACAAAGAAAGG + Intergenic
960713705 3:120555951-120555973 GGGTTTAAGTTGACAGAGAGAGG - Intergenic
960869729 3:122236542-122236564 GGGATTAAAAAAACAGATATAGG + Intronic
960870965 3:122249343-122249365 AGGTTTAAAAAGAGACAGAAAGG - Intronic
961004819 3:123397870-123397892 GGGTGAAAACAGACAGTGAAGGG + Intronic
961906396 3:130267400-130267422 TAGTTTAAAAAGAAAGACAAAGG + Intergenic
962663655 3:137631556-137631578 TGGTTTTTAAAAACAGAGAAGGG + Intergenic
963050945 3:141143115-141143137 CAGTTTAAAAAGACAAAGAGGGG - Intronic
963583723 3:147158481-147158503 GGGTATAAAAATAGAAAGAAGGG + Intergenic
963585966 3:147188814-147188836 GAGTTAGAAGAGACAGAGAAAGG - Intergenic
963705416 3:148681003-148681025 GGGGTGAAAAAGAGACAGAAAGG - Intergenic
963747590 3:149141268-149141290 GGGTTTAAAAAGACAGAGAAAGG - Intronic
964658239 3:159091834-159091856 GATTCTAAAAAGAAAGAGAAAGG + Intronic
965308119 3:167093660-167093682 GGCTCTAAAAAGAAAGAAAAAGG + Intergenic
965468590 3:169062739-169062761 GAATTTAAAATGACAGAGATGGG + Intergenic
965514562 3:169606982-169607004 GTTATTAAAAGGACAGAGAAGGG + Intronic
965880703 3:173384529-173384551 AGGTCAAAAAAGACAAAGAAAGG + Intergenic
966083807 3:176041364-176041386 GGATTAAAACAGACAGAGAGGGG + Intergenic
966539398 3:181073106-181073128 AGATTAAAAAAGACAAAGAAAGG - Intergenic
966574122 3:181480019-181480041 AGATCTAAAAAGACAAAGAAGGG + Intergenic
966997704 3:185299865-185299887 TGTTTTAAAAAGAGAGAGAGAGG - Intronic
967065467 3:185911343-185911365 GGGTTTGATAAGAAAGAGAAGGG - Intergenic
967074743 3:185991825-185991847 GCGTTTGATAAGAAAGAGAAGGG - Intergenic
968399160 4:274645-274667 TGATTTAAAAAGACTGAAAAAGG + Intronic
968714931 4:2149780-2149802 GTGTCTAAAAAGAGAGAGAGAGG + Intronic
969348439 4:6583707-6583729 GGCTTTAAAATGAGAAAGAAAGG + Intronic
969412828 4:7040909-7040931 GGGTTTAAAAGTTCAGCGAATGG - Exonic
969611616 4:8230559-8230581 GGAAGTAAAAATACAGAGAATGG - Intronic
970107206 4:12597851-12597873 AGGTAAAAAAAGACAAAGAAGGG + Intergenic
970199563 4:13589637-13589659 GGGATTAAAAGGAAAGAGATTGG + Intronic
970288164 4:14541312-14541334 GGATCAAAAAAGACAAAGAAGGG + Intergenic
970494544 4:16611598-16611620 AGGTCAAAAAAGACAAAGAAGGG + Intronic
971714858 4:30162940-30162962 TGGTTTAAAAGAATAGAGAAGGG + Intergenic
971746227 4:30584997-30585019 AAGTCAAAAAAGACAGAGAAGGG - Intergenic
971885041 4:32433754-32433776 AGATTAAAAAAGACAAAGAAGGG + Intergenic
971946732 4:33287991-33288013 GAGATTAAAATGACAGAGACAGG - Intergenic
972247134 4:37257039-37257061 GTGTTTCAAAAGACAGAAAGTGG - Intronic
972269851 4:37500870-37500892 AGATTTAAAAAGACAAAGAAGGG - Intronic
972302562 4:37798838-37798860 GTGTCTAAAAGGAAAGAGAAAGG + Intergenic
972773409 4:42219294-42219316 GGCCTTAAAAGGACAAAGAAAGG + Intergenic
972827983 4:42783911-42783933 AGATTTAAAAAGACAAAGACGGG - Intergenic
972861212 4:43170993-43171015 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
972971788 4:44585288-44585310 CAGTATAAAAAGACAAAGAAAGG + Intergenic
973064998 4:45778951-45778973 GAGTTTAAAAAGAAATAAAACGG + Intergenic
973982812 4:56320352-56320374 GAGTTTAGAATGAGAGAGAATGG + Intronic
974016627 4:56654985-56655007 GGGTTTTAAAAGTCAGCTAAAGG + Intronic
974155389 4:58065106-58065128 TGATTTAAAAAGACAAAGAAGGG + Intergenic
974275456 4:59714924-59714946 GAATTTAAAGATACAGAGAAAGG + Intergenic
974280176 4:59781685-59781707 AGATCAAAAAAGACAGAGAAGGG + Intergenic
974663206 4:64921709-64921731 GATTTTAAAAAGACAAAGAAGGG + Intergenic
974768901 4:66384945-66384967 GGATCAAAAAAGACAAAGAAGGG + Intergenic
974834579 4:67232191-67232213 AGGTTTACAAAGTCATAGAAAGG - Intergenic
974851532 4:67410464-67410486 AGATTAAAAAAGACAAAGAAGGG - Intergenic
975404291 4:73971309-73971331 AGAATTAAAAAGACAAAGAAGGG + Intergenic
975825847 4:78318863-78318885 GGGTGTAAGAAGCCAGAGGAAGG + Exonic
975998480 4:80343060-80343082 AGATTTAAAAAGACAAAGAAGGG + Intronic
976481556 4:85552773-85552795 TTTTTTAAAAAGACAAAGAAGGG - Intronic
976519361 4:86008289-86008311 GTGTTTCAAAAGTGAGAGAATGG - Intergenic
977151621 4:93520039-93520061 GGGTTTTAGAAGACTGAGGAAGG + Intronic
977305038 4:95313087-95313109 GGGTTTAAAGATTTAGAGAAAGG + Intronic
977513210 4:97988314-97988336 AGGTTAAAAAAAGCAGAGAAGGG - Intronic
977796448 4:101171158-101171180 GGCTTTCAAATGACACAGAAAGG - Intronic
978032998 4:103958882-103958904 GGGTTTTAAAAGATACATAATGG - Intergenic
978311725 4:107391560-107391582 GGGAATAAAAAGACAGGGCAAGG + Intergenic
978350492 4:107816063-107816085 GGGTTGGATAAGAGAGAGAAGGG - Intergenic
978421414 4:108537350-108537372 GGGTCTCAAAAGGCAAAGAATGG - Intergenic
978602139 4:110439810-110439832 GTGTGTAAAAAGACCGATAAGGG - Intronic
979071878 4:116218162-116218184 GAGTTAAAAAAGACAAAAAATGG + Intergenic
979076480 4:116277044-116277066 AGATCAAAAAAGACAGAGAAGGG + Intergenic
979222682 4:118247201-118247223 GGGTTTAAAAAAAAAAAAAAAGG + Intronic
979337833 4:119483896-119483918 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
979536133 4:121823098-121823120 GGGTTTAAAAGTGGAGAGAAAGG + Intronic
980218722 4:129885598-129885620 GGGTTTTGAAAGAGAGAGAGTGG + Intergenic
980987613 4:139710955-139710977 GGGGGTAACAGGACAGAGAAGGG + Intronic
981320832 4:143389212-143389234 TTGGTTAAAAAGACAGAGGAAGG - Intronic
981367334 4:143918299-143918321 GGGTTTAAAAAGAAAAACTAAGG - Intergenic
981512117 4:145568797-145568819 CAATTTAAAAAGACAAAGAATGG + Intergenic
982092864 4:151895782-151895804 AGGTTTAAGAAGCCAAAGAAGGG + Intergenic
982733198 4:158978673-158978695 GGATCAAAAAAGACAAAGAAGGG - Intronic
982763612 4:159317707-159317729 GGGATTAAAAAGAAAGAAATTGG - Intronic
982795501 4:159638940-159638962 ATGTTTCAGAAGACAGAGAATGG - Intergenic
982806294 4:159768800-159768822 TGGTTTAAAAAGAAATATAAAGG - Intergenic
983292711 4:165826377-165826399 GGACTTAGAAAAACAGAGAAAGG + Intergenic
983523692 4:168738032-168738054 GGTTTTAAAATGAAAAAGAATGG - Intronic
984183069 4:176508917-176508939 GGGTTTGTGAAGGCAGAGAAGGG + Intergenic
984419222 4:179498018-179498040 GGGTTTTGAAGGAGAGAGAAAGG - Intergenic
984445075 4:179826342-179826364 GGGTTTCAACAGCAAGAGAAGGG + Intergenic
984547098 4:181119459-181119481 AGTTTTAAAAAGAGACAGAATGG + Intergenic
984723354 4:182997551-182997573 TGATTTAAAAAGACAAAGAAGGG + Intergenic
984779041 4:183506632-183506654 GTGTCTACAAAAACAGAGAATGG - Intronic
984845378 4:184103802-184103824 TGTTTCAGAAAGACAGAGAAAGG - Intronic
985886299 5:2682328-2682350 GGGCTGAGAAAGACAGAGAAGGG - Intergenic
986110603 5:4712027-4712049 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
986250811 5:6056978-6057000 GTGTCTTAAAAGACAGAGAAAGG + Intergenic
986378590 5:7160584-7160606 GGATGAAAAAAGACAAAGAAGGG - Intergenic
987133411 5:14880030-14880052 TAGTTTAAAAAGAGACAGAAAGG + Intergenic
987505995 5:18773146-18773168 GGTTTTTAAAAGACAAAAAAAGG + Intergenic
987660880 5:20873971-20873993 TGATTAAAAAAGACAAAGAAGGG + Intergenic
987957027 5:24753548-24753570 AGGTTAAAAAAGACAAAGAAGGG - Intergenic
988018075 5:25585829-25585851 CAGTATAAAAAGACAAAGAAGGG - Intergenic
988292851 5:29312420-29312442 GGTTTTCAAAAAACAAAGAAAGG - Intergenic
988762760 5:34331714-34331736 TGATTAAAAAAGACAAAGAAGGG - Intergenic
989320472 5:40128818-40128840 GGATCAAAAAAGACAAAGAAGGG - Intergenic
989696343 5:44205391-44205413 AGATTTAAAAAGACAAAGAAGGG - Intergenic
989765522 5:45078202-45078224 GAGTTCAAAAAGACAGAGGTAGG - Intergenic
990057638 5:51603936-51603958 GGCTAGAAAAAAACAGAGAAAGG + Intergenic
990136859 5:52655788-52655810 AGAGTTAAAAAGAAAGAGAAAGG + Intergenic
990735624 5:58858520-58858542 GGGTATAGGAACACAGAGAATGG + Exonic
990940493 5:61198580-61198602 AGATTGAAAAAGACAAAGAAGGG - Intergenic
991182048 5:63763851-63763873 AGGTTCAGAAAGTCAGAGAAGGG + Intergenic
991671173 5:69049215-69049237 GGTTTTAAAAGTTCAGAGAAGGG + Intergenic
991959756 5:72032812-72032834 AGCTTTAAAAATACAGAAAAAGG - Intergenic
992101058 5:73408213-73408235 TGGTGTAACATGACAGAGAAGGG - Intergenic
992188601 5:74268114-74268136 GGGTTGAAAAAGCCAGAGAAGGG - Intergenic
993377602 5:87167870-87167892 GGGTCTAAAGACACACAGAATGG - Intergenic
993740894 5:91538061-91538083 AGATTTAAAATGACAGAAAAGGG - Intergenic
994220218 5:97186913-97186935 TGGTGGAAAAAGACACAGAATGG + Intergenic
994310425 5:98262759-98262781 GGGTCCCAAAAGCCAGAGAAAGG + Intergenic
994656239 5:102596622-102596644 AGTTTTAAAAATACAGACAAAGG + Intergenic
994958822 5:106571426-106571448 GGGTTTACACAGACATAGATGGG + Intergenic
995488227 5:112660742-112660764 TGGTCAAAAAAGACAAAGAAGGG + Intergenic
995982075 5:118116545-118116567 TGATATAGAAAGACAGAGAAGGG - Intergenic
996249734 5:121315231-121315253 GCAGTTAAAAAGACAAAGAATGG - Intergenic
996557219 5:124790943-124790965 ATGTCTTAAAAGACAGAGAAGGG - Intergenic
998937265 5:147242356-147242378 GGGTTCACAATGACAGAGCAAGG - Intronic
999055318 5:148568968-148568990 GGTGTTAAAAAGAATGAGAAGGG + Intronic
999088753 5:148916300-148916322 AAGTTTAAAAAGAAAAAGAAAGG + Intergenic
999352521 5:150888204-150888226 AGATTTAGAAAGACAAAGAAGGG + Intronic
999663910 5:153893504-153893526 ATGTTTAAAAAGAAAAAGAAGGG + Intergenic
999803377 5:155058615-155058637 GAGTCTCAAAAAACAGAGAATGG - Intergenic
999972881 5:156882770-156882792 GAGTTCAAAAACACAGAGTAAGG - Intergenic
1000041753 5:157489682-157489704 GTGGTTAAAAAGACAAAGAGGGG + Intronic
1000093445 5:157950154-157950176 GGGTTTAACAAGACAGCACATGG - Intergenic
1000459814 5:161500561-161500583 GGGATTATAAAGTGAGAGAAGGG - Intronic
1000523750 5:162329615-162329637 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1000613151 5:163397456-163397478 GTGTTTAGAAATACAGAGGATGG - Intergenic
1000986079 5:167861885-167861907 TGGATTAAAAAGAGAGAGCAAGG + Intronic
1001226431 5:169948391-169948413 GGGTATGAAAAAACAGAGAAAGG - Intronic
1003235543 6:4292391-4292413 GTGTTTTAAAACACACAGAAAGG - Intergenic
1004833954 6:19509769-19509791 AGGTCAAAAAAGACAAAGAAAGG - Intergenic
1005141716 6:22639487-22639509 GGATTGAAAGAGACAGAGAGTGG - Intergenic
1005155619 6:22802784-22802806 GGGTGGAAATAGACTGAGAAAGG + Intergenic
1005356889 6:24993335-24993357 GGGGAGAAAAAGACAAAGAAGGG - Intronic
1005415338 6:25594118-25594140 GTGTTTCTAAAGGCAGAGAAAGG - Intronic
1006191587 6:32212909-32212931 GGGCTGAACAAGACAGAGACAGG + Exonic
1006242702 6:32699604-32699626 GTGTTTAAAAATACAGGGATTGG + Intergenic
1006604320 6:35245187-35245209 GGATAAAACAAGACAGAGAAGGG - Intronic
1006721419 6:36154544-36154566 TGGTTTGACAAGTCAGAGAATGG + Intergenic
1007190156 6:40008464-40008486 GGGTTTAAAAAAATAGAATAAGG - Intergenic
1007884027 6:45205098-45205120 GGATTTCAAAAGTCAGAGATGGG - Intronic
1008613061 6:53201961-53201983 GCCTTTAAAAAAACAGAGATGGG + Intergenic
1009268091 6:61581041-61581063 GGTCTTAAAAAGAGGGAGAAGGG + Intergenic
1009332707 6:62443796-62443818 AGATTTAAAAAGATAAAGAAGGG - Intergenic
1009608508 6:65905781-65905803 GGTATAAAAAAGACAAAGAAGGG + Intergenic
1009776845 6:68216385-68216407 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1010023002 6:71182924-71182946 GGATAAAAAAAGACAAAGAAGGG + Intergenic
1010116179 6:72315377-72315399 GGGTTTTAAACTACAAAGAAGGG - Intronic
1010729167 6:79369985-79370007 GGGCTTAAAAATAAAAAGAAAGG + Intergenic
1011898345 6:92260557-92260579 GGGTTTTAAGAGAAAGAGAGGGG - Intergenic
1012014792 6:93836342-93836364 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1012082827 6:94783216-94783238 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1012412585 6:98975835-98975857 GGGTTGAACAAGAAAGAGATGGG - Intergenic
1012635431 6:101532964-101532986 AGGATGAAAAAGACACAGAAGGG + Intronic
1012870321 6:104665354-104665376 AAATTTAAAAAGACACAGAATGG + Intergenic
1012984466 6:105860052-105860074 GGGAAAAAAAAGAAAGAGAAGGG - Intergenic
1013823080 6:114178868-114178890 GGGGTTAAAAAAAAAAAGAAGGG + Intronic
1013983658 6:116164340-116164362 GAGTAAAAAAAGACAAAGAAGGG - Intronic
1014064901 6:117112939-117112961 GGATCAAAAAAGACAAAGAAAGG + Intergenic
1014124619 6:117761972-117761994 AGGTTAAAAAAGACAAAGAAGGG + Intergenic
1014255527 6:119157185-119157207 GGGTTTTAAAAGACAGACCCAGG - Intergenic
1014560397 6:122883066-122883088 AGATATAAAAAGACAAAGAAGGG - Intergenic
1014900512 6:126958182-126958204 GGTTTTAAAATGAAAGACAAGGG + Intergenic
1014967669 6:127775818-127775840 ATGATTAAAAAGAGAGAGAAAGG - Intronic
1015020642 6:128469835-128469857 GGCTTTAAAGAGAGAGAAAAAGG + Intronic
1015488367 6:133797928-133797950 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1015938787 6:138429106-138429128 GGGTTTAAAAACAAACAAAAAGG - Intronic
1015974658 6:138777481-138777503 GCTTTTAAAAATATAGAGAAAGG - Intronic
1015997308 6:139007986-139008008 GGGTACAAAAAGGGAGAGAAAGG - Intergenic
1016242103 6:141942477-141942499 AGATTTAAAAAGACAAAGAAAGG + Intergenic
1016708688 6:147144005-147144027 GGGTTTAAACAGAAAGACACGGG - Intergenic
1016774402 6:147889269-147889291 GAGTTTAAAAATACAGTGGATGG - Intergenic
1016947608 6:149548894-149548916 GGGCTTAGGAAGAGAGAGAAGGG + Intergenic
1017565821 6:155685491-155685513 GGGTATATAAAGAAAGACAATGG + Intergenic
1017877277 6:158535601-158535623 GGGAATAAAAATACAGAGCAAGG + Intergenic
1018455001 6:163943943-163943965 AGATTTAAAAAGACAGAGGAAGG - Intergenic
1018569212 6:165189485-165189507 GGGTCTAAAAAGAAAGATCATGG - Intergenic
1019091737 6:169541159-169541181 GAGGTTAAAAAGACATAAAAAGG + Intronic
1019536023 7:1530451-1530473 ATGTTTATAGAGACAGAGAATGG + Intergenic
1019859527 7:3644462-3644484 GGCTTTAAAAAGGCAGGTAAGGG + Intronic
1020563832 7:9771142-9771164 GCCTTCAAAAAGACAGAGGAGGG + Intergenic
1020635485 7:10691529-10691551 GTCTTTAAAAAAACAGAAAAAGG + Intergenic
1021425858 7:20498252-20498274 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1022855940 7:34314693-34314715 GGATTTAAACACACAGAAAATGG - Intergenic
1022871028 7:34480065-34480087 GGGTTTATAAAGAGAGTGACTGG + Intergenic
1024106935 7:46099399-46099421 TGGATTAAAAAGAGGGAGAATGG + Intergenic
1024425939 7:49226652-49226674 GGTTGTAAAATGAGAGAGAAAGG - Intergenic
1024689579 7:51784639-51784661 GGATTTTAAAAGACTGACAATGG + Intergenic
1025110945 7:56215668-56215690 GGGATCAAATAGACAGAAAAAGG + Intergenic
1025983144 7:66424536-66424558 GGGTGGAAAAAGGGAGAGAAGGG + Intergenic
1026032055 7:66802769-66802791 GGGTGGAAAAAGGGAGAGAAGGG - Intronic
1026306961 7:69150746-69150768 GGCATCAAACAGACAGAGAAAGG - Intergenic
1026318947 7:69252297-69252319 GGATTTAAAAAAACAAAGACTGG - Intergenic
1026603698 7:71798008-71798030 GAGTTAAAAAGGACAGAGAGAGG + Intronic
1028031501 7:85920031-85920053 GGATCAAAAAAGACAAAGAAGGG + Intergenic
1029786943 7:102801621-102801643 CAGTTAAAAAAGACATAGAAGGG + Intronic
1029862209 7:103584449-103584471 AAGTTTAAAAAGACTGAAAAGGG + Intronic
1030397026 7:108998811-108998833 GGGTTTAGAAAGAGAAAGGAAGG - Intergenic
1030542938 7:110855697-110855719 GAGTTTTAAAAGAAAGAGAAGGG - Intronic
1030836402 7:114292590-114292612 TGCTTTAAAAAGATAAAGAATGG - Intronic
1030858339 7:114589942-114589964 TGTTTTAAAAACAGAGAGAAGGG + Intronic
1030942546 7:115671611-115671633 GGGCTTTAAAAGACAGAAGAAGG - Intergenic
1031523320 7:122793384-122793406 AGATTTAAAAAGATAAAGAAGGG - Intronic
1031659154 7:124398799-124398821 GAGATTGAAAAGACAGGGAAAGG - Intergenic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1031789861 7:126088543-126088565 GAGTGAAAAAAGAGAGAGAACGG + Intergenic
1031876237 7:127144319-127144341 GGGATTGAAAAGACAGATGATGG - Intronic
1032169034 7:129568990-129569012 AGATTTAAAAAAACAGAAAAGGG + Intergenic
1032553574 7:132808285-132808307 GCAATTAAAAAGACAGAGAAGGG - Intronic
1032702600 7:134395826-134395848 GTGTTTAAAGAGACAGTGAGGGG + Intergenic
1033263455 7:139864106-139864128 AGGATTAAAAAGAAAGAGAATGG + Intronic
1033271102 7:139933930-139933952 GGTTTTAGAAAGAAACAGAATGG + Intronic
1033602994 7:142902259-142902281 GGGTGTGAAAAGACAGAGTGAGG + Intergenic
1033762640 7:144452376-144452398 TGGTTTCATAAAACAGAGAAAGG + Exonic
1033904875 7:146190821-146190843 CTGTTTAGAAAGAGAGAGAAGGG - Intronic
1035207135 7:157300991-157301013 GGGTTGCAAAAGACAAACAAGGG + Intergenic
1036466428 8:9002310-9002332 TGGGTTGAAAAGACAGAGATTGG - Exonic
1036809700 8:11859130-11859152 GGGTTAAAAAAAACAGAAAAGGG + Intronic
1038805201 8:30784098-30784120 GTCTTTAAAAAGAAAGAGATGGG - Intronic
1038817100 8:30915014-30915036 AAGTTGAAAAAGACAGATAATGG - Intergenic
1038941270 8:32308615-32308637 GGAGTTAAAAAGAGAAAGAATGG - Intronic
1039717265 8:40123338-40123360 TTTTTTAAAAAGAAAGAGAAAGG + Intergenic
1039732725 8:40297088-40297110 GCTTTTAAAAAGTCAGATAAAGG - Intergenic
1039813955 8:41075655-41075677 GGGTTTGAGAAGACAGAGGAGGG + Intergenic
1040434837 8:47380273-47380295 AGGTTTTAAAACACACAGAATGG + Intronic
1040727974 8:50406988-50407010 AGGTTTTAAAAAACAGACAAAGG - Intronic
1040943992 8:52862760-52862782 TGATCTAAAAAGACAAAGAAGGG - Intergenic
1041287653 8:56277019-56277041 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1041359367 8:57035673-57035695 GGGTTAAAAAGTAAAGAGAAGGG - Intergenic
1041418197 8:57637328-57637350 GGAATTTAAAAGACAGAAAATGG - Intergenic
1041506814 8:58608409-58608431 AGGTTTAAAAAGGCAGAGATTGG + Intronic
1041623892 8:60002889-60002911 TTTTTTAAAAAGACAAAGAAAGG + Intergenic
1041644974 8:60242472-60242494 GGGTTGGAAAAGACAGAGCGGGG + Intronic
1041653516 8:60325253-60325275 GTCTTTTAAAAGACAGAGAAAGG + Intergenic
1041849413 8:62372861-62372883 GCCTGCAAAAAGACAGAGAAGGG - Intronic
1041907175 8:63046448-63046470 GATTTTAAAAAGCCAAAGAAGGG - Intergenic
1042108422 8:65353849-65353871 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1042538194 8:69880466-69880488 TGGTACAAAAAGGCAGAGAAGGG + Intergenic
1042722623 8:71842147-71842169 GGGTTTTAAGTGACAAAGAAGGG - Exonic
1042752297 8:72171012-72171034 GGGATTAAAGAGACACAGAGAGG - Intergenic
1042753746 8:72186592-72186614 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1042773873 8:72407544-72407566 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1043736968 8:83760746-83760768 GGGCTTAAAAAGACTGGGCAAGG - Intergenic
1044222091 8:89680792-89680814 CGGTCAAAAAAGACAAAGAAAGG + Intergenic
1044226261 8:89722217-89722239 TGTTTTAAAAAGTCAGGGAAAGG - Intergenic
1044377895 8:91498116-91498138 GGATCAAAAAAGACAAAGAAGGG - Intergenic
1044537132 8:93370105-93370127 GGGTTTAAAGTGGCAGAGACTGG - Intergenic
1045429840 8:102103247-102103269 GGATTTGAACAGGCAGAGAAAGG - Intronic
1045679631 8:104644835-104644857 GTGTGTAAAAAGAAAGAAAAAGG - Intronic
1046296376 8:112224405-112224427 GGGTTTAAAAAAAAAGATATAGG - Exonic
1046544567 8:115633249-115633271 GGGTTTGAAAAGAGAGATGAAGG + Intronic
1046564548 8:115882546-115882568 GGGATTAAAAATGCTGAGAAGGG + Intergenic
1047305383 8:123649003-123649025 AGGATTAAGAAGACAGAGAAGGG - Intronic
1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG + Intergenic
1047653503 8:126949965-126949987 GTGTTCCAAAAGTCAGAGAAGGG + Intergenic
1047763319 8:127970192-127970214 GGGTCTGAGGAGACAGAGAAAGG - Intergenic
1048093933 8:131270558-131270580 AGGTCTGAAAGGACAGAGAATGG - Intergenic
1048280402 8:133101504-133101526 GGGTATCAAAGGACAGAGGATGG - Intronic
1049128369 8:140812766-140812788 CAGTTAAAAAAGACAAAGAAGGG + Intronic
1050234133 9:3560618-3560640 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1051721404 9:20041248-20041270 GGAATGAAAAAGACAGAGGAGGG - Intergenic
1051799564 9:20917254-20917276 GGGATTAAAAAAAAAAAGAAAGG + Intronic
1051843657 9:21427385-21427407 AGGTCAAAAAAGACAAAGAAGGG - Intronic
1051962676 9:22787507-22787529 AGATTAAAAAAGACAAAGAAGGG - Intergenic
1052241625 9:26279801-26279823 AGGTGAAAAAAGACAAAGAAGGG + Intergenic
1052369486 9:27647556-27647578 AGATCAAAAAAGACAGAGAAGGG + Intergenic
1053169286 9:35867436-35867458 GTGTTAAACAAGAGAGAGAATGG + Intergenic
1053537997 9:38945449-38945471 AGGTTTATAAAGACAAAAAATGG - Intergenic
1054628137 9:67418472-67418494 AGGTTTATAAAGACAAAAAATGG + Intergenic
1054651059 9:67623961-67623983 GAGAGAAAAAAGACAGAGAAAGG + Intergenic
1055284338 9:74712296-74712318 TGATTTTAAAAGACAGAAAATGG - Intergenic
1055523076 9:77101626-77101648 AGATAAAAAAAGACAGAGAAAGG + Intergenic
1055753253 9:79530195-79530217 GGGATTGAAAGGACAGGGAAAGG - Intergenic
1056902122 9:90609519-90609541 AGGATTAAAAAAAAAGAGAAGGG + Intergenic
1057300476 9:93876930-93876952 TTGTTAAAAGAGACAGAGAAGGG + Intergenic
1057608574 9:96520088-96520110 GGGTTTGAAAAAGCAGAGACGGG + Intronic
1057941737 9:99290943-99290965 TGGTTTAAAAAAAAAGAGAATGG - Intergenic
1058850861 9:109011461-109011483 GGGTAAAAGAAGCCAGAGAAGGG - Intronic
1058926834 9:109673854-109673876 AGGTCAAAAAAGACAAAGAAGGG - Intronic
1059227719 9:112688146-112688168 GTGTTTAAATAGACAGGAAATGG + Intronic
1059233922 9:112746291-112746313 AGGTTAAAAGAGAGAGAGAAAGG + Intergenic
1059934417 9:119294563-119294585 AAATTTAAAAAGACACAGAAAGG + Intronic
1060256611 9:122036185-122036207 GGCTATAAAGACACAGAGAAAGG - Intronic
1061288947 9:129640037-129640059 GGGCTGAAAAACACAGAGAAAGG + Intronic
1203516851 Un_GL000213v1:9396-9418 GGATGTAAAGAGACAGTGAAAGG - Intergenic
1185487470 X:494161-494183 CGGTTTAAAAAGAGAGAGGCTGG - Intergenic
1185999923 X:4997795-4997817 GGGTTTGATGATACAGAGAAAGG - Intergenic
1186563343 X:10636324-10636346 GAGTTTAAAAATAGAGAGGAGGG + Intronic
1186893346 X:13981925-13981947 GGTTTTAAAGAAACTGAGAACGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187618897 X:21028731-21028753 GGGTTTGCTAGGACAGAGAAAGG + Intergenic
1187657017 X:21487801-21487823 ATTTTTAAAAATACAGAGAATGG + Intronic
1187685410 X:21810975-21810997 TGATGTAAAAAGAAAGAGAATGG - Intergenic
1187775323 X:22750064-22750086 GGGTTTAGAAAGACAGGGCAGGG + Intergenic
1187818383 X:23257947-23257969 GGATCAAAAAAGACAAAGAAGGG + Intergenic
1188061220 X:25604261-25604283 ATTTTTAAAAAGACAAAGAAGGG - Intergenic
1188593256 X:31864852-31864874 GCGTAGAAAAAGACAGTGAATGG - Intronic
1188631812 X:32372704-32372726 GAATTTAAAAATACAGTGAAAGG + Intronic
1188988075 X:36785717-36785739 GGATGTAAAAAGGCAAAGAAAGG + Intergenic
1189449920 X:41119387-41119409 TTATTTAAAAAGAAAGAGAAGGG + Intronic
1189591578 X:42517986-42518008 GTGTGTAAAAAAATAGAGAAGGG - Intergenic
1190155119 X:47984715-47984737 GAGATTAAAAAGACACAGAATGG + Intronic
1190600402 X:52086959-52086981 AGATTTTAAAAGACAAAGAAGGG - Intergenic
1190710667 X:53066771-53066793 GGGTTTAAAACAACACGGAAGGG + Intronic
1190937515 X:55009743-55009765 GGGTGTGAAAACCCAGAGAAGGG + Intronic
1190981500 X:55460200-55460222 GTGTTTAAAAAGTCAGTGGAAGG - Intergenic
1190987198 X:55512980-55513002 GTGTTTAAAAAGTCAGTGGAAGG + Intergenic
1191037486 X:56042594-56042616 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1191072477 X:56416713-56416735 CGGTCAAAAAAGACAAAGAAGGG - Intergenic
1191119280 X:56886717-56886739 GGGTTTATATAGTCAGAGAAGGG + Intergenic
1191725542 X:64277007-64277029 AGGTCAAAAAAGACAAAGAAGGG - Intronic
1191847314 X:65556914-65556936 ATTTTTAAAAAGACAAAGAATGG - Intergenic
1192540322 X:71963918-71963940 GTCTCTAAAAAGAAAGAGAAAGG + Intergenic
1192814774 X:74578920-74578942 TGTCTTTAAAAGACAGAGAAAGG + Intergenic
1193084081 X:77433057-77433079 GGGTTAACTAAGACAGTGAAAGG - Intergenic
1193267090 X:79484461-79484483 AGGTCAAAAAAGACAGAGAAGGG + Intergenic
1193441197 X:81540500-81540522 GGGTACAAAAATAGAGAGAATGG + Intergenic
1193615776 X:83686676-83686698 AGATTTAAAAAGCCAAAGAAAGG - Intergenic
1193752533 X:85364003-85364025 ATTTTTAAAAAGACAAAGAAGGG - Intronic
1194112993 X:89859245-89859267 GTGTTTAGAAAGAGAGAGATAGG - Intergenic
1194159586 X:90434292-90434314 GGCTTTGAAAAAACAAAGAATGG + Intergenic
1194261113 X:91697376-91697398 TGATTTTAAAAGACAAAGAAGGG - Intergenic
1194281134 X:91956010-91956032 GATTTAAAAAAGACAAAGAAGGG - Intronic
1194523357 X:94945000-94945022 AGATCAAAAAAGACAGAGAAAGG + Intergenic
1194633911 X:96320715-96320737 TGATTCCAAAAGACAGAGAAAGG - Intergenic
1195541893 X:106071657-106071679 GGGTTGAAAAAAACAAGGAATGG - Intergenic
1195746213 X:108121344-108121366 GGGGTTTAAAAAACAGTGAAGGG - Intronic
1195972551 X:110489594-110489616 CAGTTTAAAAAGACAAAGAGGGG - Intergenic
1196308210 X:114128844-114128866 GTGTAAATAAAGACAGAGAAAGG - Intergenic
1196502228 X:116398433-116398455 AGGTTAAAAAGGACAGAAAAAGG - Intergenic
1196663518 X:118293416-118293438 GGTTTTAACAATAAAGAGAAGGG - Intergenic
1196982443 X:121229975-121229997 AGGTCAAAAAAGACAAAGAAGGG - Intergenic
1197526364 X:127569276-127569298 GAGTTTTAAAACACAGAAAAAGG + Intergenic
1198084352 X:133268358-133268380 GGGCTACAAAAGAGAGAGAAAGG - Intergenic
1198255250 X:134918775-134918797 GGTATTCCAAAGACAGAGAAGGG - Intergenic
1199232126 X:145448313-145448335 GGGTGAAAAAAGAAAGGGAATGG + Intergenic
1199255255 X:145712069-145712091 GGGCTTACTAAGACAGAGACAGG - Intergenic
1199293516 X:146131561-146131583 GAGGTGAAAAAGAGAGAGAAAGG + Intergenic
1199379750 X:147156101-147156123 AGGTCAAAAAAGACAAAGAAGGG + Intergenic
1199460592 X:148079958-148079980 TAGTTCAAAAAGACAGAGATGGG + Intergenic
1200368212 X:155690577-155690599 AGTTTTGAAAAGACAAAGAAGGG + Intergenic
1200415045 Y:2900888-2900910 TGGTTAAAAGAGACAAAGAAGGG + Intronic
1200465645 Y:3514075-3514097 GTGTTTAGAAAGAGAGAGATAGG - Intergenic
1200505888 Y:4011258-4011280 GGCTTTGAAAAAACAAAGAATGG + Intergenic
1200579762 Y:4936177-4936199 TGATTTTAAAAGACAAAGAAGGG - Intergenic
1200598726 Y:5180674-5180696 GATTTAAAAAAGACAAAGAAGGG - Intronic
1200743018 Y:6875756-6875778 GGGAGTAAAAGGAGAGAGAAGGG + Intergenic
1200860857 Y:7990724-7990746 AGATTTAAAAAGACAAAGAAGGG + Intergenic
1202070130 Y:20983417-20983439 AGATCTAAAAAGACAGAGAAGGG - Intergenic
1202268922 Y:23051250-23051272 GTTTTAAAAAAGACAAAGAATGG - Intergenic
1202421914 Y:24684990-24685012 GTTTTAAAAAAGACAAAGAATGG - Intergenic
1202448872 Y:24985088-24985110 GTTTTAAAAAAGACAAAGAATGG + Intergenic