ID: 963749081

View in Genome Browser
Species Human (GRCh38)
Location 3:149156390-149156412
Sequence CTGGGTCTTGAACTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963749081 Original CRISPR CTGGGTCTTGAACTGGAGAA GGG (reversed) Intronic
900371218 1:2333014-2333036 CTTGCTCTGGAACTGGAGAGTGG + Intronic
900487504 1:2930440-2930462 CTGCCTTTTGAACTAGAGAAGGG - Intergenic
900829049 1:4950939-4950961 CTGGGTCTTCAATTTGGGAAAGG + Intergenic
901144774 1:7057467-7057489 CTGTGACTTGAACTGCAGCAAGG - Intronic
901603472 1:10440853-10440875 CTGGGTCTTCACCTGAACAACGG - Intronic
903540784 1:24095087-24095109 CTGGGTCTTGACTAGGAGAAGGG + Intronic
903974248 1:27138762-27138784 GTGGGGCATGAAGTGGAGAAAGG + Intronic
905017316 1:34786506-34786528 CTGGGGCTTGAGCTGGAGCTCGG + Intronic
905638372 1:39571293-39571315 TTGGGTCTCGAAGTGGACAAAGG + Exonic
905994736 1:42371896-42371918 CTGGGTCTTGAAGTGTGGACAGG + Intergenic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
909283828 1:73789886-73789908 CTGGGTCTTGACTTGTTGAATGG + Intergenic
910467492 1:87515802-87515824 CTGGGTTTTGATCTGCAGGATGG + Intergenic
911344672 1:96681955-96681977 CCTGGACTGGAACTGGAGAAAGG + Intergenic
912802150 1:112726677-112726699 CTGAGCCGTGAACTGAAGAATGG + Exonic
913039472 1:115008594-115008616 TGGGGTCTAGAACAGGAGAAGGG - Intergenic
913235844 1:116782450-116782472 CTAGGTCATGACCAGGAGAATGG + Intergenic
915451236 1:156006861-156006883 CTGGGACTTGCTCAGGAGAATGG - Intronic
916449126 1:164902976-164902998 CTGGCTCTTGAAAGGAAGAAGGG - Intergenic
917531818 1:175842665-175842687 CTGGGTTTTGAAGAGGAAAAGGG - Intergenic
918176968 1:182055678-182055700 CTTGGCTTTGAAGTGGAGAAGGG - Exonic
919489043 1:198182374-198182396 TTAGGCCTTGAACTGGAGAGAGG + Intronic
919779886 1:201215002-201215024 CTGGGTGGTGAGCTGGAGACAGG - Exonic
920698033 1:208196592-208196614 CTGAGAATTGAATTGGAGAATGG + Intronic
921222101 1:212980575-212980597 CAGGGCCTTGAGCTGGACAATGG + Intronic
921693177 1:218176727-218176749 CTGGGTCAGGAACTGGGGAAGGG - Intergenic
923083800 1:230686118-230686140 CTGAGTCTTCATCTGGAGAATGG + Intronic
923949028 1:238926341-238926363 CTGGGACTTGCGCTGGGGAAGGG - Intergenic
924422863 1:243925402-243925424 CTGGGCCCTGCACTGGGGAAGGG + Intergenic
1063504556 10:6584011-6584033 TTGAGTCTTGATTTGGAGAAAGG + Intergenic
1064514811 10:16135308-16135330 CTGTATCTTGATCTGGACAACGG + Intergenic
1064697840 10:17986469-17986491 CTGGTTCATGGACTGGTGAAGGG + Intronic
1065420007 10:25532639-25532661 CTGGCTCTTAAAATGGGGAATGG - Intronic
1066339641 10:34518364-34518386 CTTGTTCATTAACTGGAGAATGG - Intronic
1066623879 10:37385911-37385933 CTTGGTCTTGAGCTGGGGAGGGG - Intergenic
1066704251 10:38160230-38160252 CTGGTTCATTAACTGGAGAATGG + Intergenic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069123828 10:64604754-64604776 CTGGCTGTTGAACTGGAACATGG - Intergenic
1071518831 10:86316495-86316517 CTGGGTCCAGCACTGGAGAAAGG - Intronic
1074866686 10:117547964-117547986 CTGAGTCTGGAACTGGAGTCTGG + Intronic
1074906930 10:117872828-117872850 CTCAGTCTTGGACTGCAGAAGGG + Intergenic
1076848153 10:133080171-133080193 CGGGGGCTTGAGCTGGACAAAGG + Intronic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1078175433 11:8965989-8966011 GTGGGTCTTCTACTGGACAAAGG + Intergenic
1078891055 11:15559689-15559711 CTGGGGTTTGAACTTGAGACAGG - Intergenic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079028205 11:16965611-16965633 CTGGGCTTTGAGCTGGAGTAGGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079384284 11:19965156-19965178 CTGTGTCCTCAACAGGAGAATGG - Intronic
1079535044 11:21503971-21503993 CTGGATCTAGCACTGGACAAGGG - Intronic
1080217583 11:29862954-29862976 CTGGTTCTTAACCAGGAGAATGG - Intergenic
1081897385 11:46598345-46598367 CTGGATACTGAACAGGAGAAAGG - Intergenic
1082922689 11:58512810-58512832 CTGGTTCTAGCACTGGAGCAGGG + Intergenic
1083313776 11:61801626-61801648 CTGCTTCTGAAACTGGAGAATGG + Exonic
1083928141 11:65821598-65821620 CTGGCTCAGGAACTGGAGGAAGG - Intergenic
1085237611 11:75027182-75027204 CCGGGGCTTGAACTGGAGTGAGG - Intergenic
1085299453 11:75449808-75449830 TTGGGCCTTGGTCTGGAGAAAGG + Intronic
1086454461 11:86947610-86947632 TTGGGCCTGAAACTGGAGAAGGG - Exonic
1088498964 11:110463273-110463295 CTCTGTCCTGAGCTGGAGAAGGG + Exonic
1088920433 11:114256969-114256991 CTGGGTCTTGAGGAGGAGAGGGG - Intergenic
1092287022 12:7134508-7134530 CTGGGTCTTGGCCTGGGGCAGGG + Intronic
1092388592 12:8055022-8055044 TTGGGTCTGGGACTGGAGATTGG + Exonic
1092602453 12:10082000-10082022 CCTGGGCTTGAGCTGGAGAATGG - Intronic
1092894019 12:12995910-12995932 CTGGGACTTGAACTTGACCAAGG - Intronic
1096616857 12:52838181-52838203 CTGGGTCTGGAAAGCGAGAATGG + Intronic
1096664222 12:53151826-53151848 CTGGGCCTTGTACTGGAGGGAGG + Intergenic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1098802883 12:74984857-74984879 CTGGCTCTTGTGCTGGAGACTGG - Intergenic
1099033628 12:77559650-77559672 CTGGGTCTGGAACTGCAACAGGG - Intergenic
1102199478 12:111047498-111047520 CTGGGGCTAGGGCTGGAGAATGG + Intronic
1103782434 12:123408054-123408076 CCGGCTCTTCCACTGGAGAAAGG - Exonic
1104590824 12:130083609-130083631 CTGGGTCTTGATGGGGAGATGGG + Intergenic
1105217719 13:18299083-18299105 CCGGCTCTTCCACTGGAGAAAGG - Intergenic
1105907327 13:24825699-24825721 CTTGATCTTGAACTGGACAGAGG - Exonic
1107631625 13:42348933-42348955 CTGGGTGTGGGACTGGAGATGGG - Intergenic
1107655673 13:42590120-42590142 CTGGGGCTGGAAATGTAGAAAGG - Intronic
1107822143 13:44295840-44295862 CTGGGGCTTGGGATGGAGAAGGG - Intergenic
1110304262 13:73966691-73966713 CTGTCTCTTGAACAGGAGAAAGG - Intronic
1110818218 13:79884334-79884356 CAGGGTATTGAGCTGGAGGATGG + Intergenic
1111437913 13:88236542-88236564 CAGGGTTTTGAACTGGAGCTGGG + Intergenic
1112578984 13:100662303-100662325 CTTGGTATTGAACTGGAAAGCGG - Intronic
1113807475 13:113118175-113118197 CTGGGTGTTGAGGTGGGGAAGGG - Intronic
1114502973 14:23185201-23185223 CTGTGTCTTGAACTAGCAAAAGG - Intergenic
1115644203 14:35356103-35356125 CTGGTTCTGGACCTGCAGAAGGG - Intergenic
1117406928 14:55412747-55412769 TTGGGTATGGAACTTGAGAAAGG - Intergenic
1118212658 14:63779833-63779855 CTGGGGCTTGAACTGGGGCGGGG + Intergenic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120188659 14:81420141-81420163 CTGGGTCCTGAAGTAGTGAAAGG + Intronic
1120287312 14:82520342-82520364 CTGTGTCTTTAAATGGTGAAAGG - Intergenic
1120525607 14:85573596-85573618 CTGTGTCTTGAACAGCTGAAAGG - Intronic
1121663714 14:95655511-95655533 CTGGATGTTGAACTTGTGAAAGG + Intergenic
1121928044 14:97947268-97947290 CTGGGGATTGATCTGGTGAAAGG - Intronic
1122347410 14:101069149-101069171 CGGGCCCTTGCACTGGAGAAGGG - Intergenic
1122977312 14:105176148-105176170 CTGTGTCCTGGGCTGGAGAAGGG - Intronic
1126124815 15:45285697-45285719 CTTGGCATTGTACTGGAGAAGGG + Intergenic
1128327979 15:66737513-66737535 ATGGGTGTTGAATTGGAGGAAGG + Intronic
1128687061 15:69694664-69694686 CTGGGTCCTGATGTTGAGAAGGG - Intergenic
1130541927 15:84826669-84826691 CTGGGAGATGGACTGGAGAAGGG + Intronic
1130864853 15:87924146-87924168 CTGTGTCTTCAACTGTAAAATGG - Intronic
1133062992 16:3187443-3187465 CTGAGCCTTGAAGTGGAGACTGG - Intergenic
1133601334 16:7342990-7343012 CTGGGACTGGAACTGGAGCTGGG + Intronic
1134246027 16:12540865-12540887 CTGGGTCCAGAAGTGGAAAAGGG - Intronic
1135821464 16:25690357-25690379 CTGGGCCTTGAAAGGGAGACTGG + Intergenic
1135875732 16:26198411-26198433 CTGGGTCTTGAGCTGGGGGTGGG - Intergenic
1136091274 16:27921793-27921815 CAGGGTCCTCAACTTGAGAAGGG - Intronic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137729036 16:50676598-50676620 CTGGGTCTTGAAGGGTAGACTGG - Intronic
1138317452 16:56082432-56082454 TTGGATCTGGAACTGGATAATGG - Intergenic
1139368172 16:66446672-66446694 CTGAGTCTTGGGCTGGTGAAGGG + Intronic
1139667009 16:68464341-68464363 CTGGGACAAGAACTGGACAAAGG - Intergenic
1139719500 16:68841199-68841221 CTGGGTCTAGAACTGCAGATGGG - Intergenic
1140192589 16:72830592-72830614 CTGTGTACTGAACTGGAGAGAGG - Intronic
1141909303 16:87047674-87047696 CTGGGGCTTGAACTGTGGCAGGG - Intergenic
1142482962 17:229819-229841 GTGGGTCTGGAAAGGGAGAAAGG + Intronic
1143608710 17:8005309-8005331 CTGAAGCTTGATCTGGAGAAAGG - Intronic
1144188476 17:12820482-12820504 CTAGGTCATGACCTGGAAAATGG + Intronic
1146466338 17:33089677-33089699 CTGGGTCATGAACTGAAGGTGGG + Intronic
1147839021 17:43357301-43357323 CTGGCTCTTGGAGTGAAGAAGGG - Intergenic
1149434277 17:56619961-56619983 CTTGGTCTTGAACTGATGAGGGG - Intergenic
1149553479 17:57556999-57557021 CTGAGGCCTGAAATGGAGAAGGG + Intronic
1149619153 17:58029145-58029167 CTGGCTCTTTTATTGGAGAATGG - Intergenic
1150575817 17:66430217-66430239 CAGGGACTTGAAATGGGGAAAGG - Intronic
1151286364 17:73114432-73114454 CAGAGTCTTGAAGTGGAGCAGGG - Intergenic
1152177874 17:78799728-78799750 CTGTGTCTTGGAATGGAGAGCGG - Exonic
1154056493 18:11017613-11017635 ATGGGTGTTGTACTGCAGAATGG + Intronic
1154329114 18:13415331-13415353 AAGGGTCGTTAACTGGAGAAAGG - Intronic
1156993327 18:43436872-43436894 TTGGATTTTGATCTGGAGAAAGG - Intergenic
1157148424 18:45190025-45190047 CTGGGTCCTGAACAGGACACAGG + Intergenic
1157223372 18:45842312-45842334 CAGGGTCTTGACCTTGAGCAGGG - Exonic
1161582713 19:5089574-5089596 GTGGTTCTTGAACTGGGAAAGGG + Intronic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1166093427 19:40524946-40524968 CTGGGTCTGGAAGATGAGAAAGG - Intronic
1167639282 19:50671767-50671789 CTGGCTCTACATCTGGAGAATGG - Intronic
1168284955 19:55326581-55326603 CTGGGTCTGACACTGGAGAAAGG + Intronic
1168452051 19:56474243-56474265 CTGGGTATTGAATTGGGGGAGGG + Intronic
925063110 2:908724-908746 CTGTGTCTTCACCTGGGGAAAGG - Intergenic
925568108 2:5279046-5279068 CTGGGTGTTCAGCTTGAGAAAGG - Intergenic
926397469 2:12458808-12458830 CTGGTTCTAGCACTGGAGTAGGG - Intergenic
926971750 2:18473666-18473688 CTGTGTCCTGGACTGGGGAATGG - Intergenic
927871628 2:26627805-26627827 CTGGGTCTTGAAATAGAGGCAGG - Intronic
928687023 2:33760372-33760394 CTGTGTCTTAGCCTGGAGAAAGG + Intergenic
929788019 2:45005927-45005949 CTGAGTCTTGAACCACAGAAGGG - Exonic
931243483 2:60473338-60473360 CTGGGTCTTCAAAAAGAGAATGG + Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932396643 2:71453551-71453573 CTCGCTCTTGGACAGGAGAAAGG - Intergenic
932424414 2:71620051-71620073 CTGGTTCTTGTCCTGGAGGAGGG + Intronic
934296589 2:91747566-91747588 CCGGCTCTTCCACTGGAGAAAGG + Intergenic
935486823 2:103666548-103666570 CTGGGGGTTGAACAGAAGAAAGG + Intergenic
936536551 2:113316142-113316164 CAGGGTCATGTACTGGGGAAGGG + Intergenic
937072179 2:119072884-119072906 GTGGGTCTGGGACTGGAGATAGG - Intergenic
937083186 2:119154835-119154857 CTAGGTCTGGAACTGGGGGAGGG + Intergenic
937277291 2:120693148-120693170 CTGGTTCTTTGAGTGGAGAAGGG - Intergenic
938053859 2:128198842-128198864 CTGGAGCTTGAGCTGAAGAAGGG - Intergenic
938093371 2:128447378-128447400 CTGGGTCTGGAGCTGGGCAAAGG + Intergenic
940037877 2:149329828-149329850 CAGGGGCTTTAACTGGAGGAAGG + Intergenic
940384246 2:153051778-153051800 CTTGGTCTTAAACTGCAGCAGGG - Intergenic
941905752 2:170715553-170715575 CTCGGCCCTGACCTGGAGAAAGG - Exonic
942149011 2:173056485-173056507 TTGGGACTTGAACAGGTGAATGG - Intergenic
945244003 2:207701586-207701608 CTGGTTCTTCAACTGTAAAATGG + Intergenic
946502813 2:220267628-220267650 CTGTGGCTTCAACTGTAGAATGG + Intergenic
946803851 2:223450277-223450299 GTGGGACTTGAACTTGAGCAGGG + Intergenic
946982511 2:225232935-225232957 CTGGCTCTTTTACTGGAGAGTGG + Intergenic
947572599 2:231248001-231248023 CTGGGTTTGGAGCTCGAGAAAGG - Intronic
1168849215 20:965236-965258 CTGGGTCTTGAAGTGGGGGTGGG + Intronic
1168967234 20:1906160-1906182 CTGGCTCTTTATCTGTAGAATGG - Intronic
1169278109 20:4247043-4247065 CTGGGTCTGGGACTGGAGGCTGG - Intronic
1170847690 20:19975692-19975714 CTGGGTCATGAACTGCCGGATGG - Exonic
1170865221 20:20149695-20149717 CCTGGGCTTGAGCTGGAGAATGG - Intronic
1172379073 20:34473511-34473533 CTCTGTCCTGAGCTGGAGAAGGG - Intronic
1172481506 20:35274533-35274555 CTTGTTCTTGAACTGGAAGATGG - Exonic
1173859064 20:46270197-46270219 CTGGGTCTTAACTTGGAGATAGG + Intronic
1174674565 20:52341023-52341045 CTCGGTCTTGAATTAAAGAATGG - Intergenic
1178306327 21:31493750-31493772 CCTGGTCTGGAGCTGGAGAAGGG + Intronic
1179463629 21:41555863-41555885 GTGAATCTTGAACTGGAGAATGG - Intergenic
1179492308 21:41748752-41748774 CTGGGGCTTGAGCAGGAGGAAGG + Intronic
1181063403 22:20293070-20293092 CTGTCTCCTGAGCTGGAGAACGG + Intergenic
1182360073 22:29741093-29741115 CTGCGGCTTGGAGTGGAGAAAGG - Intronic
1183991283 22:41598619-41598641 CTGGATCTGGAAGAGGAGAAAGG + Exonic
950374629 3:12560804-12560826 CTGAGACATGAACTGGAGGAGGG - Intronic
950722211 3:14891482-14891504 CTGAGTCTTGAACTAACGAATGG - Intronic
950885187 3:16356597-16356619 CTGGTTATTGAAGTGGAGATGGG - Intronic
951184799 3:19701155-19701177 CTGGGGCATGAGCTGGAGAATGG - Intergenic
952265098 3:31777859-31777881 CCTGGGCTTGAGCTGGAGAATGG - Intronic
952501247 3:33964216-33964238 CTGGTTCTCTAACTGGACAAGGG - Intergenic
953103835 3:39855966-39855988 CTGGGGCTTGAGCTGGAGACTGG + Intronic
954342726 3:49968505-49968527 CTTGGTCTTGAACTGGACTTTGG - Exonic
956766574 3:72489299-72489321 CTGTGTCTTCATCTGGAAAATGG - Intergenic
956783036 3:72619420-72619442 TTGGGTCATGATTTGGAGAAAGG - Intergenic
960162312 3:114363951-114363973 CTGTATCTTGAATTGGAGGAAGG - Intronic
960694256 3:120380550-120380572 CTGGGCCTTGAAGTGGGCAAGGG + Intergenic
961073584 3:123961340-123961362 CTGGGCCTGGAGCAGGAGAAAGG - Exonic
961309986 3:125990484-125990506 CTGGGCCTAGAGCAGGAGAAAGG + Intergenic
962369152 3:134806386-134806408 CTGGGACTTGAGCTGGAGCTGGG - Intronic
962906151 3:139804944-139804966 CTAGGTCTTTAGCTGGAGAGAGG - Intergenic
963492453 3:146018361-146018383 CTGCTTCCAGAACTGGAGAAGGG - Intergenic
963749081 3:149156390-149156412 CTGGGTCTTGAACTGGAGAAGGG - Intronic
965051926 3:163662443-163662465 ATGGCTCTGGAACTGGATAATGG + Intergenic
965232628 3:166072709-166072731 CTGGGTTTTGAACTTGCGTAGGG + Intergenic
965520414 3:169664056-169664078 CTAGTTCTTTAACAGGAGAAGGG - Intergenic
965763463 3:172106089-172106111 ATGGGTTTTGAATTGGAGTATGG + Intronic
965866820 3:173215033-173215055 CCTGGGCTTGAGCTGGAGAATGG + Intergenic
967815375 3:193794030-193794052 CTGGGTCTTCAACTGGAAAATGG - Intergenic
968300139 3:197606624-197606646 CTGTGTCCTGACCTGGAGATGGG - Intergenic
969062615 4:4449976-4449998 CTGATTCTTAAACTGGAGCAGGG - Intronic
969607122 4:8207849-8207871 CTGGCTTTTCAACTGGAGGATGG + Intronic
970693571 4:18647667-18647689 CTGAGTCTTTACGTGGAGAAAGG - Intergenic
971192754 4:24443399-24443421 CTGGCTCTGGCACTGGGGAAGGG + Intergenic
972649288 4:41000937-41000959 CTGAGGCTTGTTCTGGAGAAAGG + Intronic
974125177 4:57687459-57687481 CTGGGTCTAGAATTTGAGCAGGG + Intergenic
976727407 4:88228166-88228188 CTGCTTCCTGAACAGGAGAAGGG - Intronic
977577192 4:98687678-98687700 CTGGGCGATGAACAGGAGAATGG - Intergenic
977762674 4:100758699-100758721 CCTGGTCTTGAGCTGGAGACTGG - Intronic
979005093 4:115284325-115284347 CTGGGTAGTGGACTGGAGAAAGG + Intergenic
981052856 4:140328308-140328330 CAGTGTTTTGAACTGAAGAAAGG + Intronic
981451606 4:144904689-144904711 ATGTGTCTAGAACTGGATAAGGG - Intergenic
983776053 4:171609114-171609136 CCTGGTCTTGCACTGGAGACTGG - Intergenic
984097313 4:175448657-175448679 CTGGGTCTTGGCCTGAACAAGGG - Intergenic
984993599 4:185406099-185406121 CTGCTTCTTGAACTGTATAAAGG + Intronic
985625302 5:982498-982520 CTGGGCCTGGAGCTGGGGAAAGG - Intergenic
985886595 5:2684847-2684869 GTGGGGCTTCCACTGGAGAAAGG + Intergenic
986886449 5:12242992-12243014 CTGGGTCTAAAACACGAGAAAGG - Intergenic
990456705 5:55995310-55995332 CGGGGTCATGAACTGGAGCCCGG + Intergenic
991403538 5:66278792-66278814 CTGGGTCTTCACCTGGTGGAAGG + Intergenic
991543135 5:67751936-67751958 CCTGGGCTTGAGCTGGAGAATGG - Intergenic
992952546 5:81874697-81874719 TTGGGACTTGAACTGAAAAATGG - Intergenic
993954485 5:94215683-94215705 CTGGGACTTAAACTGGTGAATGG + Intronic
995282840 5:110355149-110355171 CTGGATCTGGAATGGGAGAAGGG - Intronic
997225456 5:132206196-132206218 CAGTGTCTGGAACTGAAGAACGG + Intronic
997441082 5:133909021-133909043 CTGGGCCTTGAACAGTAGATGGG + Intergenic
998250589 5:140549513-140549535 CAGGGGCTGGAACTGGGGAATGG + Exonic
998568632 5:143237830-143237852 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
998568646 5:143237876-143237898 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
998629735 5:143884723-143884745 CTGGGTGTTACACTGGAGAAAGG - Intergenic
1000022063 5:157326699-157326721 CTGGTTCTAGAAGGGGAGAATGG + Intronic
1000635096 5:163634992-163635014 CTGGGAGTTGAACTTGAGACTGG + Intergenic
1001752755 5:174144205-174144227 GTGGGTCAGGAATTGGAGAATGG + Intronic
1004341311 6:14810271-14810293 CTGCATCATGAACTTGAGAAGGG - Intergenic
1009992667 6:70863337-70863359 CAGGGTCTGGAACAGGAGACTGG - Intronic
1012077775 6:94714397-94714419 TTGGGCCTTGAATTGCAGAAAGG + Intergenic
1012264101 6:97120179-97120201 TTAGGTCTTGAACATGAGAAGGG + Intronic
1012550999 6:100464754-100464776 CTGGATCATGAATTGGAGGAGGG + Exonic
1013276294 6:108587919-108587941 CTGGGACATGCACTAGAGAAGGG + Intronic
1013675349 6:112454751-112454773 CTGTGTCTTGATCAGTAGAATGG + Intergenic
1014978580 6:127919852-127919874 ATGTGTTTTGAACTGGAGATGGG - Intergenic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1016425720 6:143934000-143934022 CCTGGGCTTGAGCTGGAGAATGG + Intronic
1016495509 6:144657467-144657489 CTGAGTCCTGGACAGGAGAAAGG - Intronic
1017941209 6:159054902-159054924 CTGGGTATTGAGTTGGAAAATGG + Intergenic
1018171891 6:161150319-161150341 CTAGGTCTTCTCCTGGAGAAGGG + Intronic
1018350838 6:162957170-162957192 CAGGGTCCTCACCTGGAGAATGG + Intronic
1019310577 7:358706-358728 ATGGGTCATGAACTTGAGAGTGG - Intergenic
1019550343 7:1599272-1599294 AAGGGTCTTGCACAGGAGAAAGG + Intergenic
1019880810 7:3859188-3859210 GTGGGTCATGAATTGGAAAAGGG + Intronic
1020646036 7:10815445-10815467 CTGGGTTTTGGAATGGAGTATGG - Intergenic
1021676397 7:23084709-23084731 CTGGCTCTTGGACTGAACAAGGG - Intergenic
1022203160 7:28137498-28137520 CTGGGTGGGGAACTGGAAAAGGG - Intronic
1023370565 7:39508627-39508649 CTGGGTCCTGATGTGAAGAAGGG + Intergenic
1026326164 7:69312609-69312631 CTAGGTCTTGATGTGGTGAAAGG + Intergenic
1029538987 7:101172116-101172138 CTGGGACTGGAGCTGGTGAAGGG - Exonic
1031450060 7:121904935-121904957 CTGGGTCTTTAACTTGAGTTTGG + Intronic
1033540929 7:142355379-142355401 CTGGGTCTTCGAGTGGACAAAGG - Intergenic
1033552145 7:142457320-142457342 CTGGGTCTTGGAATGGACAAAGG - Intergenic
1033554417 7:142476262-142476284 CTGGATCTTGGAATGGACAAAGG - Intergenic
1033559049 7:142513819-142513841 CTGGGTCTTGGAATGGACAACGG - Intergenic
1033815064 7:145061068-145061090 GTTGATCTTGAAATGGAGAAGGG + Intergenic
1034979649 7:155467827-155467849 CTGGGGCTGGGGCTGGAGAAGGG - Intergenic
1035311146 7:157969781-157969803 CTGGAGCTTGCACAGGAGAAAGG + Intronic
1035771170 8:2148099-2148121 ATGGGTCTAGGACTGGAGCAGGG - Intronic
1036640316 8:10579535-10579557 CAGGGTCTTGACCTGGAAGATGG - Intergenic
1036692285 8:10951589-10951611 CAGGGTCTTCACCTGCAGAATGG + Intronic
1037860434 8:22401362-22401384 CTGCTTCTTGGTCTGGAGAAAGG + Intronic
1037927809 8:22858183-22858205 GTGGGTGTTGAAATGGTGAAAGG + Intronic
1038834922 8:31108881-31108903 CTGGGGCTTGAACTTGAGCTTGG - Intronic
1040914237 8:52552866-52552888 CTGGTTCTTTTACTGGAGAATGG + Intronic
1041734175 8:61092618-61092640 CTGGCCCTGGAAATGGAGAAGGG - Intronic
1042525913 8:69764529-69764551 CTGTGTTTGGAAATGGAGAATGG + Intronic
1044255513 8:90055949-90055971 CTGTTTCTTGACCTGGAGAATGG - Intergenic
1044657244 8:94561383-94561405 CCTGGGCTTGAACTGGAGAATGG + Intergenic
1045556321 8:103218145-103218167 ATGGGACATGAAGTGGAGAAGGG - Intronic
1048057663 8:130883791-130883813 CTCAGCTTTGAACTGGAGAAGGG - Intronic
1048293496 8:133197839-133197861 CTGAGTCTGGGAGTGGAGAAAGG + Intronic
1049022769 8:139969172-139969194 CTGGATCTTGAACATAAGAACGG - Intronic
1050372772 9:4938944-4938966 CTGGAACTTGAACTTCAGAAGGG + Intergenic
1052795094 9:32916120-32916142 CTGGGTGCTGAAATGGAGACTGG - Intergenic
1053293590 9:36898090-36898112 CTGGGTTTGGAAATGGAGGATGG + Intronic
1055271034 9:74558867-74558889 CTGGGACTTTAGCTGTAGAAAGG + Intronic
1055284253 9:74711645-74711667 CTTGGTTTTCAACTTGAGAAAGG - Intergenic
1055838419 9:80473500-80473522 ATGGGTTTTGACCTGGGGAACGG - Intergenic
1057936447 9:99243392-99243414 CTGTGTTTTGAAGTGAAGAATGG - Intergenic
1058186697 9:101863784-101863806 CTGGCTCTTGAAAGGGAGAAAGG + Intergenic
1058478788 9:105369741-105369763 CTGGGTCCTTCACTAGAGAAAGG + Intronic
1060972882 9:127748869-127748891 CTGAGTCCTGAACCGGAGAGGGG - Intronic
1186203289 X:7175788-7175810 CTAGCTCATGAACTGGATAATGG - Intergenic
1186963801 X:14765495-14765517 CTTACTCTTCAACTGGAGAACGG - Intergenic
1187494487 X:19782803-19782825 CTGTTATTTGAACTGGAGAAAGG - Intronic
1188885696 X:35546736-35546758 TTGGGTCCTGAACTCGAGCATGG + Intergenic
1189144312 X:38640069-38640091 ATGGGTTTTGAAATGGAGCAAGG + Intronic
1190949515 X:55129573-55129595 TTGCTTCTTGCACTGGAGAATGG + Intronic
1190998676 X:55637056-55637078 CTGGGTCTTCAACTGCAGTTTGG - Intergenic
1192317652 X:70065557-70065579 CTGGGGCATGGACTGGTGAAGGG + Intergenic
1194017236 X:88638202-88638224 CTGGGTCAGGATGTGGAGAAAGG + Intergenic
1194858518 X:98964584-98964606 TTGTGTCTTGAACTTGAAAATGG + Intergenic
1195217827 X:102717741-102717763 ATGGTTCTTAAACTGAAGAAGGG - Intergenic
1195961801 X:110394771-110394793 CTGCCTCTTCAACTGGAAAATGG + Intronic
1198382417 X:136096528-136096550 CTGGGACTAGAGCTGGAGAGAGG + Intergenic
1200864811 Y:8032169-8032191 CAGGCTTTTGAACTGAAGAAAGG - Intergenic
1200948690 Y:8870664-8870686 CTGGGTCTTTATTTGGAAAATGG + Intergenic