ID: 963749786

View in Genome Browser
Species Human (GRCh38)
Location 3:149164710-149164732
Sequence CCCTCAGGTCAGAAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963749786_963749792 5 Left 963749786 3:149164710-149164732 CCTCATTGCTTCTGACCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 963749792 3:149164738-149164760 GCTGACCCGCAGCCCCTCCTTGG 0: 1
1: 0
2: 5
3: 31
4: 321
963749786_963749793 6 Left 963749786 3:149164710-149164732 CCTCATTGCTTCTGACCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 963749793 3:149164739-149164761 CTGACCCGCAGCCCCTCCTTGGG 0: 1
1: 0
2: 0
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963749786 Original CRISPR CCCTCAGGTCAGAAGCAATG AGG (reversed) Intronic
900266231 1:1758742-1758764 TCCTCAGTTCAGCAGCAAAGAGG + Intronic
902248006 1:15134467-15134489 CCCTGGGGTCAGAGGCACTGGGG + Intergenic
903674767 1:25056674-25056696 CCCTCTGGTCAGAAGGCATGAGG - Intergenic
907160286 1:52364569-52364591 CCCTCAGGCCAGAGGCCAAGGGG - Exonic
911886062 1:103301024-103301046 CAATCATGGCAGAAGCAATGGGG + Intergenic
913533546 1:119750089-119750111 CCTTCTGGGGAGAAGCAATGAGG - Intronic
914509304 1:148317492-148317514 CCCTCAGGACAAAAGGGATGGGG - Intergenic
914917202 1:151826079-151826101 CCCCCAGTCCAGAAGCACTGGGG - Intronic
917509445 1:175658173-175658195 CCCTCAGGTCAGCAGCCCTCAGG + Intronic
919743707 1:200995494-200995516 CCCTGAAGTCAGAAGCACAGGGG + Intronic
921593259 1:217027699-217027721 CCCACAGATCAGAAGGAAGGTGG + Intronic
922092618 1:222411182-222411204 CCCTCTGGGCAGAGGCACTGAGG + Intergenic
923623025 1:235593341-235593363 AGGTCAGGTCAGAAGCACTGGGG - Intronic
923877632 1:238066691-238066713 TCACCAGGACAGAAGCAATGAGG - Intergenic
924738420 1:246779989-246780011 CCCTCAGGAGAGAAGCCAAGTGG - Intergenic
1063188124 10:3668585-3668607 CCCCCAGGGCAGATGCAAGGGGG - Intergenic
1069421515 10:68250841-68250863 CCCTCAGGCTAGAGACAATGTGG + Intergenic
1069841576 10:71342767-71342789 CCATCAGGGCAGGAACAATGAGG + Intronic
1069912004 10:71765536-71765558 CCCTCAGGGTCTAAGCAATGGGG + Intronic
1070344683 10:75530489-75530511 CACTGAGGTCAGCAGCAAGGAGG - Intronic
1074312555 10:112334607-112334629 CTCTTAGGTCAGCAGCTATGTGG + Intergenic
1074546877 10:114408166-114408188 CCCCCAGGTGAGAAGCTATGGGG + Intergenic
1074952964 10:118357766-118357788 CCCTCAGGTCTGTGGCACTGGGG - Intergenic
1075966971 10:126621426-126621448 CCTTCATGTCAGGAACAATGTGG + Intronic
1076269153 10:129135510-129135532 TCCTCATGTCAGAAGCAGGGTGG + Intergenic
1076552179 10:131288456-131288478 CTCTCAGGACAGACGCACTGTGG + Intronic
1076593861 10:131612320-131612342 CCCTCAGGTTAAAAGCAAAAAGG - Intergenic
1077059335 11:610885-610907 CCCTCTGGCCAGAGGCACTGTGG - Intronic
1081199319 11:40197471-40197493 CCCTCAACTCAGTAGCTATGTGG - Intronic
1084022126 11:66424015-66424037 CACTCAGTTCAGGAGCACTGGGG - Exonic
1084477606 11:69397870-69397892 CCCTGTGGTCAGAAAGAATGTGG + Intergenic
1089188941 11:116640599-116640621 CCCTAAGGTTACAAGCAACGAGG + Intergenic
1089326820 11:117663229-117663251 CCGTGAGATCAGAAGCACTGTGG - Intronic
1091070182 11:132555646-132555668 CCCTCAAGTCTGAAGAAAGGAGG + Intronic
1096996633 12:55842337-55842359 CTCTGAGGTGAGAAGCTATGAGG - Exonic
1097009109 12:55940014-55940036 CCCTCAGGTAAGAAGGAAATAGG + Intronic
1102082262 12:110108030-110108052 ATCTCAGGTCAGCAGCAGTGGGG - Intergenic
1103037788 12:117670569-117670591 TGCTCAGGTCAGAGGCACTGGGG + Intronic
1111887305 13:94038711-94038733 CACTGAGGGCAGAAGAAATGTGG + Intronic
1112047960 13:95616664-95616686 CCCAGAGGCCAGAGGCAATGGGG + Intronic
1112180406 13:97073305-97073327 GCATCAGCTCAGTAGCAATGGGG + Intergenic
1112708428 13:102099118-102099140 CCCTCAGCTGAGAAGGGATGGGG - Intronic
1113494518 13:110715961-110715983 CCCTCGGGTCAGCAGAGATGCGG - Exonic
1115234857 14:31199481-31199503 ACCTCAGGTCAGAACCCAGGAGG - Intronic
1116615229 14:47128038-47128060 CCCACAGCTCATAAGGAATGGGG - Intronic
1117167022 14:53045681-53045703 CCCTCAGATGAAAAGCACTGTGG + Exonic
1117290634 14:54329110-54329132 CCCTCATGTAAGAAGCAGTGGGG + Intergenic
1118855680 14:69620186-69620208 CCCACAGGACAGAAACAAGGAGG - Intronic
1122185659 14:99992758-99992780 CCCTAAGATCAGAAGAAATAAGG - Intronic
1125739938 15:41955465-41955487 CCCTCAGCTGAGAGGAAATGGGG - Intronic
1126394203 15:48195337-48195359 GGTTCAGGTGAGAAGCAATGAGG - Intronic
1128691339 15:69726851-69726873 CCCCCAGGCCAGCAGCAAAGGGG - Intergenic
1129918451 15:79295817-79295839 TTCTCAGGTGAGAAGCAGTGAGG + Exonic
1130117172 15:81015185-81015207 CCCTCAGGTCAGCAGCAAACTGG + Intronic
1130384437 15:83398925-83398947 CCTGCAGGTCAGATGGAATGAGG + Intergenic
1131098411 15:89670226-89670248 CCTTCAGCTCAGAAGCAATCTGG + Exonic
1137001428 16:35233770-35233792 CCCCCAGGACAGAGGCACTGGGG + Intergenic
1139480729 16:67229172-67229194 CCCTCATGCCTGGAGCAATGAGG + Exonic
1140349019 16:74243893-74243915 CCCAGAGGTCAAAAGCAAAGTGG + Intergenic
1143312026 17:6000029-6000051 CACTCAGGCAAGAAGCAGTGAGG - Intronic
1143720326 17:8804668-8804690 CCCTCAGGTCAGGAGTTATAAGG - Intronic
1146573209 17:33970258-33970280 CCCCCAGGTGAGAACCAGTGGGG + Intronic
1148130347 17:45258378-45258400 CCCTGAGGTCAGAAGCCTGGGGG - Intronic
1151399696 17:73848047-73848069 CATTCAGCTCAGAAGCAATTTGG - Intergenic
1151586106 17:75009293-75009315 CCCTCAGGGAAGAAGGAAAGAGG + Intergenic
1152006055 17:77681952-77681974 CCCACAGTTCAGGAGCGATGTGG + Intergenic
1152837713 17:82545050-82545072 CCACTAGGTCAGCAGCAATGGGG - Intronic
1156339286 18:36196803-36196825 CCCACAGGTTACTAGCAATGTGG + Intronic
1158213768 18:55078773-55078795 CCTTCAGGGCAGCAGTAATGGGG - Intergenic
1160117828 18:76098623-76098645 CTCTCAGGTCAGAGCCAATACGG + Intergenic
1161200051 19:3009562-3009584 CCCCCAGGTCAGCAGCTCTGTGG - Exonic
1161283825 19:3458939-3458961 CAGTCAGGGCAGCAGCAATGGGG - Intronic
1162027898 19:7904573-7904595 TCCTCGGGTCAGAAGAGATGGGG - Intronic
1164082293 19:21868952-21868974 CCCTCAGGCCAGAATCACAGTGG + Intergenic
1166222196 19:41372682-41372704 GCCTCTGGTCTGAAGCAAAGAGG - Intronic
1166349846 19:42191422-42191444 CCCTTAGGTCTGAAGGAGTGAGG - Intronic
925199402 2:1954055-1954077 CCCTCAGGACAGGAGAAATCTGG + Intronic
925851546 2:8086837-8086859 CCCTCATCTCAGATGCAGTGGGG + Intergenic
926383937 2:12317499-12317521 CCAGCAGGCCAGAAGCAGTGTGG + Intergenic
927040908 2:19229244-19229266 CCCTCAGGACAGAAGCTTAGAGG + Intergenic
931758663 2:65396818-65396840 CCTTCAGGACTGAAGCACTGAGG - Intronic
931769822 2:65487860-65487882 TCCTCAGGTCAGAACAACTGGGG - Intergenic
931773039 2:65515921-65515943 CCCTCTGGTCATAAGCTGTGAGG + Intergenic
935658356 2:105443956-105443978 CCCTGAGCTGAGAAGCCATGGGG + Intergenic
936977282 2:118232590-118232612 CACTCAGCAAAGAAGCAATGAGG + Intergenic
940136720 2:150445420-150445442 CTCTCAGGTCAGAAGAAGTGAGG - Intergenic
941296539 2:163745694-163745716 CCATCATTTCAGAAGCAATCAGG + Intergenic
945874942 2:215268127-215268149 CCCTCAGGTCAGAGGGAAGCTGG - Intergenic
945997238 2:216447866-216447888 CCCTAAGGTCTGAATTAATGTGG - Intronic
947822092 2:233079121-233079143 CCCTGAGTGCAGAAGCAGTGGGG + Intronic
1175118848 20:56702984-56703006 CCCTCAGGGCAGATGCATTTGGG + Intergenic
1175168057 20:57060265-57060287 ATCTCAGGACAGAGGCAATGGGG + Intergenic
1181795380 22:25304996-25305018 TCCTCAGGCCAGCAGCAAGGAGG + Intergenic
1181835918 22:25608513-25608535 TCCTCAGGCCAGCAGCAAGGAGG + Intronic
1182818396 22:33189681-33189703 CCCACATGCCAGCAGCAATGGGG - Intronic
1184348287 22:43926127-43926149 GCCTCAGCTCAGATGCACTGAGG - Intronic
1184989202 22:48155864-48155886 CCCTCAAGACAGAAGCATTCTGG + Intergenic
949293759 3:2496388-2496410 CACAAAGTTCAGAAGCAATGGGG + Intronic
950236364 3:11324667-11324689 CCCTAAGGACAAAGGCAATGGGG - Intronic
950642712 3:14358849-14358871 CCCTCAGGGCCCAAGCAGTGAGG - Intergenic
951764760 3:26185349-26185371 CCCTCAGGGCAGAAGGAAGAAGG - Intergenic
951922653 3:27873186-27873208 CTCTCAGGTCAGCAGAAATTGGG + Intergenic
952725841 3:36583166-36583188 GCCTCAGGTCTGAACCACTGAGG + Intergenic
953832976 3:46317837-46317859 TCCACTGGTCAGAAGCAAGGAGG - Intergenic
954631312 3:52049231-52049253 CCGTGAGGTAAGAAGCAGTGGGG + Exonic
956431879 3:69195066-69195088 TCCTCAGGTCAGAAGACGTGTGG - Exonic
956467821 3:69536340-69536362 CCCTCAACTCCGAAGCAAGGGGG - Intronic
958982713 3:100742485-100742507 CCATCAGCTCAGTAGCAAAGTGG + Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
963749786 3:149164710-149164732 CCCTCAGGTCAGAAGCAATGAGG - Intronic
967131715 3:186476785-186476807 CCCTCAGGGCAGCAGCTCTGGGG + Intergenic
968491204 4:891580-891602 CACTCAGATGAGAAGCACTGAGG + Intronic
969655790 4:8497815-8497837 CACTCAGGTGAGAGGCAGTGAGG + Intergenic
971380118 4:26088938-26088960 TCCCCAGGTCAGAGGGAATGGGG + Intergenic
976285918 4:83371000-83371022 CCTTCAGGGCAGCAGCAAAGAGG + Intergenic
978184247 4:105838250-105838272 CCCACAGGGCAGAAGCAAATGGG + Intronic
978399362 4:108314496-108314518 CCCTGAGGTGAGAGGGAATGTGG - Intergenic
986202589 5:5591536-5591558 GCCTGAGTTTAGAAGCAATGAGG - Intergenic
986247620 5:6025117-6025139 ACCTCAGGAGAGAGGCAATGCGG + Intergenic
986422403 5:7598283-7598305 ACCTCACCTCAGAAGCAAGGTGG + Intronic
987879396 5:23722631-23722653 CCTTCAGGTCAGAGGCAACATGG + Intergenic
988855066 5:35220265-35220287 ACCCGAGGTAAGAAGCAATGAGG - Intronic
988920351 5:35935688-35935710 CCATAAGGTCAGAAGCAAGTTGG - Intronic
991301228 5:65131291-65131313 CCCTTATCTCATAAGCAATGGGG - Intergenic
992882676 5:81126109-81126131 CCTTCAGGTCAGAATCACAGTGG + Intronic
995381018 5:111533419-111533441 CCCTCAGGAAAGGAGGAATGGGG - Intergenic
1000676651 5:164130054-164130076 CCCTGAGGACAGGAGCATTGGGG + Intergenic
1001003915 5:168032638-168032660 CCCTCAAGGCAGAGGCAGTGGGG + Intronic
1001797148 5:174511884-174511906 CCCGCCTCTCAGAAGCAATGTGG + Intergenic
1004920123 6:20368410-20368432 CCCTCAGCTCAGAAGCATGGGGG + Intergenic
1006729671 6:36227535-36227557 CCCTGAGGGCAAAAGCAAGGTGG - Intronic
1007493128 6:42239912-42239934 CCCTAAGCTCACAAGTAATGAGG + Intronic
1007849824 6:44792370-44792392 AGCTCAGGTCAGAAGTAACGAGG + Intergenic
1012100581 6:95081104-95081126 CCGTAAAGTCAGAAGAAATGAGG + Intergenic
1013452275 6:110295482-110295504 CCCTCTGGTCAGACGCCCTGGGG - Intronic
1013980965 6:116128704-116128726 CCCTCAGGACAGCAGGAGTGGGG - Intronic
1014177953 6:118350528-118350550 CTCTCAGGCTAGAAGCAATTTGG + Intergenic
1015477898 6:133673640-133673662 TCCAAAGGTCAGTAGCAATGTGG + Intergenic
1017230462 6:152068108-152068130 CTCTCATGTCAGATGCAAAGAGG - Intronic
1017476183 6:154795682-154795704 TCCTCAGGTGGGAAGCAATGTGG + Intronic
1018940451 6:168306189-168306211 CCCTCAGGGCTGATGCAGTGGGG - Intronic
1018968493 6:168508032-168508054 TCCTCAGGTCAGGAGCTCTGAGG + Intronic
1020759312 7:12248455-12248477 TCCTCACGTCAGAAGGGATGAGG - Intergenic
1022468985 7:30670420-30670442 CCCTCAGGACAGAGCCATTGAGG + Intronic
1023121534 7:36914185-36914207 CACTCAGGTCAGTATCAAGGAGG - Intronic
1024522323 7:50316333-50316355 CCCTGCTGTCAGAAACAATGTGG + Intronic
1027477284 7:78649022-78649044 CTGTCAGGTCAGCACCAATGTGG + Intronic
1030188647 7:106789415-106789437 CCAACAGGTAAGAAGAAATGGGG - Intergenic
1030909829 7:115233423-115233445 CCCTGAGGACTGAAGCATTGTGG + Intergenic
1035319679 7:158020576-158020598 CCGTCAGGACAGAAGCAGTCAGG + Intronic
1039119470 8:34129748-34129770 CCCTCATTTTAGAAGCAAGGAGG - Intergenic
1040112342 8:43572079-43572101 CCCCCAGGCCAGAATCAAGGGGG - Intergenic
1041111905 8:54490967-54490989 CCCTCAGACCAGATGCAAGGAGG - Intergenic
1043656535 8:82674462-82674484 CCTTCAGTACAGAAGCTATGGGG - Intergenic
1047219705 8:122909738-122909760 CCCACAGGACAGCAGCAGTGGGG - Intronic
1049991528 9:996170-996192 CCCTGAAGGCAGAAGCAATAAGG - Intergenic
1051043441 9:12843757-12843779 CACTCAGGTCATCAGCAATAAGG - Intergenic
1056233603 9:84570673-84570695 GCCTCAGGTTAGAAGGAATCAGG + Intergenic
1059666035 9:116447443-116447465 CACACAGGTCAGAATGAATGAGG + Intronic
1061824653 9:133250561-133250583 CTTTCTGGACAGAAGCAATGTGG - Intronic
1188820421 X:34768084-34768106 CCATCAGGGCAGAGGGAATGAGG + Intergenic
1189108000 X:38256514-38256536 TCCTCGGGTCAGAAGAGATGGGG - Intronic
1189578319 X:42379391-42379413 CCCTGAGGTGAGAATCAATGTGG - Intergenic
1192035818 X:67561877-67561899 CCCAAAGGGCAAAAGCAATGAGG + Intronic
1192402633 X:70851965-70851987 AGCTAGGGTCAGAAGCAATGAGG + Intronic
1194781411 X:98029070-98029092 CCCCCAGGAGAGAAGCAAAGTGG - Intergenic
1200768087 Y:7097712-7097734 CCCCCAGTTCAAAAGCAAAGAGG - Intergenic