ID: 963764942

View in Genome Browser
Species Human (GRCh38)
Location 3:149324779-149324801
Sequence ATGGAACCCCAAAGTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963764942 Original CRISPR ATGGAACCCCAAAGTGATCA TGG Intronic
901867897 1:12119314-12119336 TTGGCACCCCAAAGTGCTCCAGG + Intronic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
903897894 1:26620764-26620786 TTGGAACCCCGAAGAGATAAGGG + Intergenic
909542114 1:76802878-76802900 ATGGAACCCCCAATTTATGATGG - Intergenic
909948148 1:81687461-81687483 ATGGACACCAAAAGTGAGCAGGG - Intronic
912220660 1:107670881-107670903 TTGGAACCTCAAACTGTTCAAGG - Intronic
912503057 1:110135297-110135319 ATGGAAGCACAAAGTCATCTTGG - Intergenic
913463944 1:119119242-119119264 ATGGACACCAAAAGTGAGCAGGG + Intronic
914455281 1:147830990-147831012 ATGGACACCAAAAGTGAGCAGGG - Intergenic
915224679 1:154403881-154403903 ATGGAACTCCCAAGTGGACAGGG - Intergenic
916285236 1:163098971-163098993 GTGGAAGCAAAAAGTGATCAAGG - Intergenic
917217291 1:172691494-172691516 GTGGAAGCAAAAAGTGATCAAGG + Intergenic
917250895 1:173059762-173059784 ATGGTAACCCAAAAAGATCATGG - Intergenic
918619836 1:186590386-186590408 ATGAAACCCCCAAGTCATCAAGG + Intergenic
918795603 1:188890978-188891000 ATGGAAACCAAAAGAGACCAGGG + Intergenic
921834717 1:219766054-219766076 ATGGACACCAAAAGTGAGCAGGG + Intronic
922658078 1:227403043-227403065 ATGGACACCAAAAGTGAGCAGGG + Intergenic
923753200 1:236766047-236766069 AGGGAACCCGAAAGAGCTCAAGG - Intergenic
923950399 1:238945000-238945022 ATGGAGCACCAAAGTGTGCAAGG - Intergenic
1063434830 10:6021347-6021369 ATGGAAGCCCAGGGAGATCAAGG + Intronic
1066543643 10:36475905-36475927 ATGGAAGCAAAAAGTGATCAAGG - Intergenic
1066735906 10:38478786-38478808 ATGTAACCCCAGAATGATTAAGG + Intergenic
1068480979 10:57587632-57587654 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1068815967 10:61313351-61313373 ATGGAAACCCAAAGAGAGCAAGG - Intergenic
1069841450 10:71341914-71341936 ATGGAACCCCAAGTTGCTGAGGG - Intronic
1071481419 10:86067788-86067810 ATGGCACCACAGAGTCATCATGG - Intronic
1071671620 10:87614322-87614344 ATGGCATCCCAATGTGAACATGG + Intergenic
1073701103 10:105927578-105927600 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1075743842 10:124712740-124712762 CTGGCACCCCAACCTGATCATGG + Intronic
1076156298 10:128208231-128208253 ATGGATACCCAAGGTGTTCAGGG - Intergenic
1076687370 10:132204191-132204213 ATGGAACCCAGGAGTGAGCATGG + Intronic
1077309227 11:1881104-1881126 AGGGAGCCCCAAACTGATGAGGG + Intronic
1077380168 11:2230175-2230197 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1079500665 11:21097996-21098018 ATGAAACTACAAACTGATCAGGG - Intronic
1079634136 11:22714195-22714217 ATGGAAACCAAAAGTGAGCAGGG + Intronic
1080164252 11:29217868-29217890 ATGGAACCTGAGAGTGATCTTGG - Intergenic
1083518214 11:63280782-63280804 ATGGAAACCAAAAGTGAGCAGGG - Intronic
1087310412 11:96535371-96535393 GTGGCACCCCAAAGTGCTCACGG + Intergenic
1087503534 11:98991487-98991509 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
1088137507 11:106576111-106576133 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1090545447 11:127761384-127761406 ATGGAAACCAAAAGTGAGCAGGG + Intergenic
1093488506 12:19679457-19679479 ATGGACACCAAAAGTGAGCAGGG - Intronic
1094268317 12:28583942-28583964 AGAGGACGCCAAAGTGATCATGG + Intergenic
1094363228 12:29652331-29652353 ATGGAACCCCAATATCATCTTGG - Intronic
1095732949 12:45524777-45524799 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1096892195 12:54782964-54782986 AAGGAACTCCAAAGGGTTCAAGG + Intergenic
1096918619 12:55060114-55060136 ATGGAAACCTTAAGTAATCAAGG - Intergenic
1096957038 12:55536677-55536699 ATGTACACCAAAAGTGATCAGGG + Intergenic
1098346661 12:69512157-69512179 ATGAAACCCAAAAGAGAACAGGG - Intronic
1099777226 12:87149461-87149483 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1101237546 12:102804781-102804803 ATGGAACCCCAGAGTAGTCCGGG - Intergenic
1101635066 12:106533598-106533620 ATGGACACCAAAAGTGAGCAGGG - Intronic
1101747293 12:107552659-107552681 ATCGAAGCCCAGAGTGATGAGGG + Intronic
1104227956 12:126855025-126855047 ATGGAAATCCAAAGAGACCAAGG + Intergenic
1105337223 13:19484799-19484821 ATGGAAGCCAAAAGTGAGCAGGG - Intronic
1106072746 13:26428356-26428378 ATGGAAACCAAAAGAGAGCAAGG + Intergenic
1106302754 13:28484463-28484485 AAGGAGCCCCAAAGCCATCAAGG - Intronic
1106581070 13:31018838-31018860 ATGGAACCTCAGAGTGCCCAGGG + Intergenic
1107555255 13:41512427-41512449 ACGGAACCCCACACTGCTCACGG + Intergenic
1109653360 13:65357380-65357402 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1111401398 13:87740808-87740830 ATGGAACCTCAAAGTTATAATGG - Intergenic
1111590338 13:90338945-90338967 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1112747514 13:102543396-102543418 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1116058828 14:39896336-39896358 ATGGAAAGGAAAAGTGATCAAGG - Intergenic
1116732195 14:48638002-48638024 ATGGACACCAAAAGTGAGCAAGG + Intergenic
1118364807 14:65085787-65085809 ATGGAACCCCCAAGTCACCTGGG + Intronic
1119107650 14:71939438-71939460 GTGGAAGCAAAAAGTGATCAAGG + Intronic
1120231503 14:81845855-81845877 ATGGAAGGGAAAAGTGATCAAGG + Intergenic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1120972489 14:90219575-90219597 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1121318527 14:92976519-92976541 ATGGAAATCCAAAATGATAATGG - Intronic
1121677038 14:95761824-95761846 AAGGAAACCCACAGTGATGAGGG + Intergenic
1122226004 14:100279934-100279956 AAGGCACCCCCAAGGGATCAAGG - Exonic
1124418829 15:29498967-29498989 ATGGAAACCAAAAGAGAGCAGGG - Intronic
1125412509 15:39420196-39420218 ATTGAACCCCAAAGATATGATGG + Intergenic
1128364749 15:66990768-66990790 ATGGAAACCAAAAGAGATCAGGG + Intergenic
1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG + Intergenic
1130191351 15:81738969-81738991 ATGGAACCCCAACATGAACTGGG + Intergenic
1131435789 15:92420474-92420496 ATGAAAGCCCAAAGTTCTCAGGG + Intronic
1134242865 16:12518598-12518620 ATGGAACCCACAGGTGCTCAGGG - Intronic
1138674182 16:58639057-58639079 CTTGAACCCGAAAGGGATCAAGG - Intergenic
1140189139 16:72799964-72799986 ATGGAATGCCAAAATGTTCATGG - Intronic
1140232461 16:73128940-73128962 ATTGAACCCCAAAGAGATCCTGG + Intronic
1140911544 16:79457758-79457780 CAGGCACCCCAGAGTGATCAAGG + Intergenic
1141167941 16:81672943-81672965 ATGGAAGCCCCAAGAGAGCAGGG - Intronic
1143991028 17:10961759-10961781 ATGGACACCGAAAGTGAGCAGGG + Intergenic
1146583602 17:34061695-34061717 ATGGATACCAAAAGTGAACACGG + Intronic
1147462982 17:40587218-40587240 ATGGACACCAAAAGTGTTCAGGG - Intergenic
1148408045 17:47437579-47437601 ATGGACACCAAAAGTGAGCAGGG - Intronic
1149214586 17:54338952-54338974 ACGGAACTTCAAAGTAATCAAGG - Intergenic
1149943492 17:60896643-60896665 ATGGAAACCAAAAGTGAACAGGG - Intronic
1152974190 18:197300-197322 ATGGAAACAGTAAGTGATCAGGG - Intronic
1153083542 18:1256526-1256548 AGGGAACCTCAAAGACATCAAGG + Intergenic
1153168718 18:2291511-2291533 ATGGACACCAAAAGTGAGCAAGG - Intergenic
1153400674 18:4680940-4680962 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1153578328 18:6545478-6545500 ATGGAACAACAAACTGATCATGG + Intronic
1156140809 18:34108518-34108540 ATGGTAACCAAAAGGGATCAGGG + Intronic
1157541052 18:48507309-48507331 ATGGACACCAAAAGTGATCAGGG + Intergenic
1158756713 18:60333756-60333778 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1159196101 18:65117344-65117366 TTGAAACACCAAAGGGATCAAGG - Intergenic
1159596276 18:70385531-70385553 CTAGAACCCCAATGTGATCAGGG + Intergenic
1160267414 18:77352066-77352088 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1162053155 19:8047069-8047091 ATGAAAACCGAAAGAGATCAGGG + Intronic
1163371597 19:16904094-16904116 ATGGAGCCCCAAAGAGGGCAGGG - Intronic
1164340091 19:24385392-24385414 ATGGAAGCCTATGGTGATCAAGG + Intergenic
925174106 2:1770330-1770352 CTGCAACCCTAAAGCGATCATGG + Intergenic
926823657 2:16880851-16880873 CTGAAACCGCAAGGTGATCAAGG - Intergenic
928733913 2:34263324-34263346 ATGGACACCAAAAGTGAGCAGGG + Intergenic
930406948 2:50970456-50970478 TTGGAACTCCAAAGTAATCTAGG - Intronic
932259203 2:70312991-70313013 ATGGAGCCCCAGAGTGATGTGGG + Intergenic
932270507 2:70404895-70404917 ATGGACACCAAAAGTGAGCAGGG + Intergenic
932550753 2:72766990-72767012 ATTGAAGCCCAAAGAGAACAAGG + Intronic
934158999 2:89230387-89230409 AAGGAACCCCATTGTGAACAGGG - Intergenic
934208275 2:89952038-89952060 AAGGAACCCCATTGTGAACAGGG + Intergenic
935954172 2:108358719-108358741 ATGGACACCAAAAGTGAGCAGGG + Intergenic
937058071 2:118956313-118956335 ATGGACACCAAAAGTGAGCAGGG + Intronic
937781776 2:125846981-125847003 ATGGACACCAAAAGTGAGCAGGG - Intergenic
939068983 2:137517249-137517271 GTGGAAGCACAAAGTGATCAAGG - Intronic
939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG + Intronic
940091134 2:149919084-149919106 ATGGAAACCAAAAGAAATCAGGG + Intergenic
940172162 2:150841171-150841193 ATGGACACCAAAAGTGAGCAGGG - Intergenic
942084262 2:172428909-172428931 ATGCAACCCCATAGCGATTAAGG - Intronic
943258823 2:185631637-185631659 ATGGAACCATAAAGTGTTAATGG + Intergenic
943891088 2:193288361-193288383 ATGGACACCAAAAGTGAGCAGGG - Intergenic
945463785 2:210143260-210143282 ATGGAAACCAAAAGAGAGCAGGG - Intronic
946178513 2:217936466-217936488 AAGGAAGCCCAGAGGGATCAGGG + Intronic
1169925141 20:10775530-10775552 ATGGAACAGAAAAGAGATCAAGG + Intergenic
1170245549 20:14218333-14218355 ATGGACACCAAAAGTGAGCAGGG - Intronic
1172186807 20:33036013-33036035 ATGGGACCCCAAAATGATGGAGG - Intronic
1176736343 21:10550404-10550426 ATGGAAGCCCAAAGTGAGCAGGG + Intronic
1178060837 21:28851745-28851767 ATGGAAGGGAAAAGTGATCAAGG + Intergenic
1179432917 21:41336892-41336914 ATGGAAACCAAAAGAGAGCAGGG - Intronic
1180649160 22:17364559-17364581 TTGTAATCCCAAAGTGAGCAGGG - Intronic
950954532 3:17037285-17037307 ATGGATCTCCAAGGTGGTCATGG + Intronic
951180892 3:19657130-19657152 ATGGAAATCAAAAGTGAGCAGGG + Intergenic
951572282 3:24077229-24077251 ATGGACACCAAAAGTGAGCAGGG - Intergenic
951852112 3:27152833-27152855 ATGGACACCAAAAGTGAGCAAGG + Intronic
952609405 3:35189614-35189636 ATGGAGCACAAAAGTGATTATGG - Intergenic
953352894 3:42229526-42229548 TTGGAGCCCCAAACTCATCAGGG - Intergenic
953579640 3:44142166-44142188 AATGCCCCCCAAAGTGATCAAGG + Intergenic
953740835 3:45537790-45537812 ATGGCACCCCAGAGTGATCATGG - Intronic
954216005 3:49124881-49124903 ATGGGTCCCCAAAGTGCCCAGGG + Exonic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955231171 3:57100019-57100041 CTGGAATCCCAAACTGATTAAGG - Intronic
955859899 3:63317553-63317575 ATGGACACCAAAAGTGAGCAGGG - Intronic
958848592 3:99294454-99294476 AAAGAAGCCCAAAGTCATCAGGG + Intergenic
958969725 3:100598805-100598827 ATGGACACCAAAAGTGAGCAGGG - Intergenic
959226856 3:103597885-103597907 GTGGAAGCTAAAAGTGATCAAGG + Intergenic
959654903 3:108792095-108792117 AGGGAAGCCCAAAGTGAAGATGG + Intergenic
962474914 3:135747085-135747107 TTGGAGACCCAAAGAGATCAAGG + Intergenic
962972093 3:140411246-140411268 ATGGAAACCAAAAGAGATCAAGG + Intronic
963355745 3:144207441-144207463 GTGGAAGCAAAAAGTGATCAAGG + Intergenic
963764942 3:149324779-149324801 ATGGAACCCCAAAGTGATCATGG + Intronic
964409090 3:156379613-156379635 GTGGAACCACAGAGTGAACAAGG + Intronic
965928686 3:174015233-174015255 ATGGCAGCCCAAACTGACCAAGG - Intronic
967203075 3:187092321-187092343 ATGGAAACCAAAAGAGAGCAGGG - Intergenic
968125447 3:196156222-196156244 ATGGACACCAAAAGTGAGCAGGG - Intergenic
970205098 4:13647765-13647787 ATTGAACCGCAAAGCCATCATGG - Intergenic
970257996 4:14189328-14189350 ATGGAAAGCCAGTGTGATCAAGG - Intergenic
970972929 4:22005859-22005881 ACGCCACCCCAAAGTGAACATGG + Intergenic
972201382 4:36717760-36717782 GTGGAAGCAAAAAGTGATCAAGG + Intergenic
976556399 4:86455476-86455498 ATGGACACCAAAAGTGAGCAGGG + Intronic
976601182 4:86938797-86938819 ATGAGACCCCAAGGTCATCAGGG + Intronic
976686128 4:87817550-87817572 ATGGACACCAAAAGTGAGCAGGG - Intergenic
977388003 4:96369504-96369526 ATGAAAACCAAAAGTGAGCAGGG - Intergenic
978772237 4:112468395-112468417 GTGGAAGCAAAAAGTGATCAAGG + Intergenic
979417083 4:120455188-120455210 ATGGAAGCCCAAACTCATCACGG - Intergenic
979675139 4:123401592-123401614 ATGGATCCCCAAAATCAACATGG + Exonic
979766935 4:124473986-124474008 GTGGAAGCAAAAAGTGATCAAGG - Intergenic
979995610 4:127427139-127427161 ATGGACACCAAAAGTGAGCAGGG + Intergenic
980087007 4:128401919-128401941 ATGGACACCAAAAGTGAGCAGGG - Intergenic
980347392 4:131638606-131638628 ATGGAAACCAAAAGAGAGCAAGG + Intergenic
981461575 4:145018768-145018790 ATGGACACCAAAAGTGAGCAGGG + Intronic
981742327 4:148015723-148015745 AAACAACCCCAAGGTGATCAGGG + Intronic
984721930 4:182980570-182980592 ATGGACACCAAAAGTGAGCAGGG + Intergenic
986161760 5:5236138-5236160 ATGGAAGCACACAGTAATCATGG + Intronic
986261671 5:6152842-6152864 GTGGAAGCAAAAAGTGATCAAGG + Intergenic
986921599 5:12690328-12690350 ATCTTACCCCAAAGTGAGCATGG - Intergenic
987293920 5:16533574-16533596 AGGGAGCCCCAAGGTGATTATGG + Intronic
988107684 5:26771937-26771959 GTGGAAGTGCAAAGTGATCAAGG - Intergenic
990236521 5:53773985-53774007 CTGGAACCCAAAAGAGACCAGGG + Intergenic
990352568 5:54933635-54933657 ATGAAAGCCCAAAGTGTTCAAGG + Intergenic
993174245 5:84461762-84461784 ATGTAACACCAAAATGACCAAGG - Intergenic
993420142 5:87691493-87691515 ATGGTAACCCAAAGGGAGCAGGG - Intergenic
993964948 5:94348637-94348659 ATGGACACCAAAAGTGACCAGGG + Intronic
995378056 5:111500223-111500245 ATTAAATCCCAAAGTGACCATGG + Intronic
995789726 5:115872421-115872443 ATGAAACCACAAGGTAATCATGG + Intronic
995927616 5:117394328-117394350 AAGGACTCCCAAAGTTATCAGGG - Intergenic
995955533 5:117771792-117771814 ATGGACACCAAAAGTGAGCAGGG + Intergenic
996427286 5:123328460-123328482 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
996678538 5:126204159-126204181 ATGGACACCAAAAGTGAGCAGGG + Intergenic
997761133 5:136448404-136448426 ATGGACACCAAAAGTGAGCAGGG + Intergenic
998531228 5:142886810-142886832 ATGGAATCCCAAATTTATCATGG - Intronic
998875420 5:146594098-146594120 ATTGTACCCAAAAGTGAACATGG - Intronic
999484491 5:151981988-151982010 ATGGACACCAAAAGTGAGCAGGG - Intergenic
999818829 5:155203946-155203968 ATGGACCCCAAAAGTGATCAGGG + Intergenic
1003063357 6:2879596-2879618 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1003196610 6:3920464-3920486 TTGGAATCCCAGAGTGATCAAGG + Intergenic
1005072707 6:21876513-21876535 ATGGACACCGAAAGTGAGCAGGG + Intergenic
1006743521 6:36325592-36325614 ATGGAAGCACAAAGGGATAAGGG - Intronic
1008484397 6:52019658-52019680 ATGGAAAGCTAAAGTGATTAAGG - Intronic
1008973374 6:57396471-57396493 ATGGACACCAAAAGTGAGCAGGG - Intronic
1009162277 6:60298015-60298037 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1009333065 6:62449385-62449407 ATGGAAGTGCAAAGTGATCAAGG + Intergenic
1010017210 6:71119278-71119300 ATGGAAACCAAAAGTGAGCAAGG - Intergenic
1010925639 6:81742683-81742705 ATGGAATGCTAAAATGATCAAGG - Intronic
1011327356 6:86163785-86163807 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1011328875 6:86181996-86182018 ATGGACACCAAAATTGATCAGGG - Intergenic
1012600401 6:101090036-101090058 ATGGAAACCAAAAGTGAGCAAGG - Intergenic
1012738029 6:102975658-102975680 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1012965844 6:105671739-105671761 ATGGAAACCAAAAGCGAGCAGGG + Intergenic
1014363481 6:120508959-120508981 GTGGAATCAAAAAGTGATCAAGG + Intergenic
1015289089 6:131518083-131518105 ATGGAAACTAAAAGTGAGCAGGG - Intergenic
1015565787 6:134569242-134569264 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1015926170 6:138312336-138312358 ATAGATCCCCAAAGAGATCCAGG - Intronic
1016419696 6:143871283-143871305 GTGGAAGCAAAAAGTGATCAAGG + Intronic
1016567268 6:145470110-145470132 ATAGAACAACAAAGTGACCATGG + Intergenic
1016793526 6:148092398-148092420 ATGGAAACCAAAAGAGAACAGGG + Intergenic
1017359036 6:153543952-153543974 AGGGAACCCCAAAATGAAGATGG + Intergenic
1018484339 6:164225699-164225721 ATGAAAACTGAAAGTGATCATGG + Intergenic
1018938381 6:168289773-168289795 CTGAAACACCAAAGTGATAAGGG - Intergenic
1019940726 7:4287412-4287434 AACTAACCCCAAAGGGATCATGG - Intergenic
1020332171 7:7030565-7030587 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
1022538753 7:31115922-31115944 TTGGATCCCCAAAGTGTTCCTGG + Intergenic
1023701473 7:42895426-42895448 ATGGACACCAAAAGTGAACAGGG + Intergenic
1023748760 7:43349676-43349698 ATGGACACCAAAAGTGAGCAGGG - Intronic
1023850650 7:44148219-44148241 ATGGCAACCCAAAGTGAGTAAGG + Intronic
1024513226 7:50219369-50219391 TTGTGACCCCAAAGTGCTCAAGG - Intergenic
1024917016 7:54513366-54513388 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1026153482 7:67807888-67807910 ATGGATCCCCAAAGGGGTCTTGG - Intergenic
1026245498 7:68615985-68616007 ATCTAACCCCAAATTGCTCAGGG - Intergenic
1028043780 7:86090860-86090882 GTGGAAGCAAAAAGTGATCAAGG - Intergenic
1028929237 7:96394705-96394727 ATGGAAACCAAAAGGGAGCAGGG - Intergenic
1029192446 7:98781301-98781323 CAGGAACCCCAAAGTGCTCCAGG + Intergenic
1030277374 7:107735505-107735527 GTGGAAGCGAAAAGTGATCAAGG - Intergenic
1030936204 7:115587211-115587233 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1031572703 7:123378605-123378627 ACATAACCCCAAAGTGAGCATGG - Intergenic
1034313057 7:150106899-150106921 TTAGAACCCCAAAGAGATCTGGG + Intergenic
1034793807 7:153993765-153993787 TTAGAACCCCAAAGAGATCTGGG - Intronic
1037587995 8:20291170-20291192 ATGGAGATCCAGAGTGATCAAGG + Intronic
1038360907 8:26875770-26875792 ATGGAAGCCAAAAGAGAACAGGG - Intergenic
1039330556 8:36532458-36532480 GTGGAAACCAAAAGCGATCAAGG - Intergenic
1039641682 8:39229519-39229541 ATGGACACCAAAAGTGAGCAGGG + Intronic
1042584765 8:70323937-70323959 ATGGGACCCCAGACTGTTCAGGG - Intronic
1042640945 8:70933326-70933348 ATGGAAACCCAAAGGAATAATGG + Intergenic
1043816677 8:84810809-84810831 ATGGACACCAAAAGTGAACAGGG - Intronic
1043989561 8:86735702-86735724 AGGTAACCCCAATGTAATCAAGG - Intronic
1044218765 8:89645489-89645511 ATGGAAGCCCAGAGTGATGAAGG - Intergenic
1044845997 8:96382322-96382344 ATGGAAGACCCAAGTAATCATGG + Intergenic
1046585853 8:116148242-116148264 GTGGAAGCCAAAAGCGATCACGG + Intergenic
1049235190 8:141508652-141508674 ATGGGAGCCCAAAGAAATCAGGG - Intergenic
1050040245 9:1484108-1484130 ATGGAAACCAAAAGAGAACAGGG - Intergenic
1051341865 9:16119580-16119602 ATCCCACCCCAAAGTGAACATGG + Intergenic
1051342705 9:16126741-16126763 ATGGAAACCCAAAGAGGTGAAGG + Intergenic
1051912525 9:22170721-22170743 AAGTTCCCCCAAAGTGATCAGGG + Intergenic
1052247169 9:26349622-26349644 ATGGAAACCAAAAGCGAGCAGGG + Intergenic
1053050816 9:34958939-34958961 ATGGAACCCTACAGGGATCCCGG - Intronic
1055682130 9:78726463-78726485 ATGGAAACCAAAAGTGTTCAGGG + Intergenic
1056126808 9:83542703-83542725 ATATAAAACCAAAGTGATCAAGG + Intergenic
1056322526 9:85450205-85450227 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1056702405 9:88921797-88921819 TTGAACCCCCAAAGTGACCACGG + Intergenic
1058156531 9:101522534-101522556 ATGGAAAGCAAAAGTGAGCAGGG - Intronic
1058410665 9:104727198-104727220 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1058622995 9:106903743-106903765 ATGGACACCAAAAGTGAGCAGGG - Intronic
1060982933 9:127803841-127803863 GTGGAACCCCAGAGTCATGAGGG + Intronic
1203781115 EBV:101371-101393 ATGGACCACCAATGTGATCGTGG - Intergenic
1187681587 X:21772446-21772468 ATGGATACCAAAAGTGAACAGGG + Intergenic
1187773399 X:22728650-22728672 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1188998861 X:36920955-36920977 ATGGAAACAAAAAGAGATCATGG - Intergenic
1189072198 X:37875439-37875461 AGGGAAGCCCAAAGTCAACAGGG + Intronic
1189413868 X:40796741-40796763 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1190159735 X:48022572-48022594 CTGGAACCCCAAAGGGAGCCAGG + Intronic
1190631995 X:52397007-52397029 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1191906089 X:66092078-66092100 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1191994274 X:67074111-67074133 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1192820431 X:74638974-74638996 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1193578719 X:83234695-83234717 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1193590894 X:83387542-83387564 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1194285393 X:92004699-92004721 ATGGAAACCCAAAATGAGCAAGG - Intronic
1194354055 X:92858517-92858539 ATGGAAACCAAAAGTGAGCAAGG + Intergenic
1194596563 X:95866318-95866340 ATGGAAACCAAGAGTGAGCAGGG + Intergenic
1194883495 X:99283225-99283247 ATGGAATTTCAAAGTGAACATGG - Intergenic
1195014346 X:100763893-100763915 ATGGGATCCCAAAGTGGTAAAGG - Intergenic
1195984967 X:110619859-110619881 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1196219098 X:113090236-113090258 ATGGAAAGCAAAAGTGAGCAGGG + Intergenic
1196465042 X:115962949-115962971 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1196737720 X:118994357-118994379 ATGGACACCCAAAATGAGCAGGG + Intronic
1196982966 X:121236081-121236103 ATGGAAGCCAAAAGAGAGCAAGG - Intergenic
1197386899 X:125813303-125813325 GTGGAAGCAGAAAGTGATCAAGG + Intergenic
1198089752 X:133316285-133316307 GTGGAGCCCCAAAGAGATTAAGG + Intronic
1198852514 X:140980335-140980357 CTGGAACCCCAAAGTGGCCCAGG + Intergenic
1200602964 Y:5229238-5229260 ATGGAAACCCAAAATGAGCAAGG - Intronic
1200662409 Y:5975536-5975558 ATGGAAACCAAAAGTGAGCAAGG + Intergenic
1200974273 Y:9191922-9191944 ATGGAACCACATAGCCATCAGGG - Intergenic
1202136603 Y:21671710-21671732 ATGGAACCACATAGCCATCAGGG + Intergenic