ID: 963765641

View in Genome Browser
Species Human (GRCh38)
Location 3:149333377-149333399
Sequence GTTCTAAGCAGGGCAAAATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963765641 Original CRISPR GTTCTAAGCAGGGCAAAATG GGG (reversed) Exonic
900940315 1:5794297-5794319 GCTCTGAGCAGGGCAAGACGAGG + Intergenic
903174792 1:21574501-21574523 GATGTTAGCAGGGCAACATGAGG - Intronic
904400611 1:30254162-30254184 GTTCCAGGAAGGGCAAGATGAGG - Intergenic
906243291 1:44255902-44255924 GTTCAAATTAGGACAAAATGTGG - Intronic
913356387 1:117927320-117927342 GTTCAAAACTGGGCAAAATTGGG + Intronic
915148272 1:153808555-153808577 GTTCTCAGCAGAGAAGAATGAGG - Exonic
916862561 1:168821987-168822009 TTTCTAAGAAGGGCATAAGGGGG - Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921757476 1:218875851-218875873 TTTCTTAGCAAGGCAAAAGGAGG + Intergenic
924024255 1:239816467-239816489 GTTTAAAGCAAGGCAAACTGAGG + Intronic
1065444471 10:25783693-25783715 GTTTCAAGGAGGGCAGAATGTGG - Intergenic
1067001475 10:42618031-42618053 CTCCTAAGCAGGTCTAAATGTGG - Intronic
1070236233 10:74629412-74629434 GATATGAGCAGAGCAAAATGAGG + Intronic
1070236386 10:74631692-74631714 CATATAAGCAGAGCAAAATGAGG + Intronic
1071483328 10:86080708-86080730 GTGCTACGCAGGGAAAACTGGGG + Intronic
1072628878 10:97132163-97132185 GTTCTAGGCACTGCAAACTGAGG + Intronic
1072914265 10:99527434-99527456 GTACCAGGCAGGGCACAATGAGG + Intergenic
1073534675 10:104266143-104266165 GTTCAAACCAGGGCCAGATGAGG - Exonic
1073558962 10:104481067-104481089 GTTTCAGGCAGGGCAGAATGGGG + Intergenic
1074453547 10:113578446-113578468 GTTTTAAGCAGGATTAAATGTGG + Intronic
1076040588 10:127244709-127244731 CTTCAAAGCAATGCAAAATGGGG - Intronic
1081855747 11:46302416-46302438 TTTCTAAGTGGGGCACAATGTGG - Intronic
1081912362 11:46707943-46707965 ATTCTGAGCAGGGCACAGTGAGG + Intergenic
1082852595 11:57778622-57778644 GAGCTGAGCAGGGCAAAGTGGGG + Intronic
1083642408 11:64152702-64152724 GTTCTAATCAGGGAGAAACGGGG - Intronic
1084198358 11:67539247-67539269 TTTCTTAGAAGGGCAAACTGAGG + Intergenic
1085981541 11:81732497-81732519 GTTCTAAGCAACTCAAACTGGGG + Intergenic
1089231969 11:116985850-116985872 TTTCTATGTAGGGAAAAATGAGG - Intronic
1090353174 11:126120936-126120958 GATCTAAGGAAGCCAAAATGGGG + Intergenic
1092003419 12:5049321-5049343 GTCCCCAGCAGGGCAAGATGAGG - Intergenic
1094293456 12:28877505-28877527 GTTTTGAGCAGGTCAAATTGAGG - Intergenic
1096306669 12:50483960-50483982 GTCCTAACCATGGCAAAATGGGG + Intergenic
1096547659 12:52351947-52351969 GTTTTGAGCTGGGCAGAATGAGG + Intergenic
1096762746 12:53856287-53856309 GTTCTATGGAGGACACAATGCGG - Intergenic
1097542048 12:60954611-60954633 GTTCTAGGCCAGGTAAAATGGGG + Intergenic
1097953292 12:65456781-65456803 GTTCTATGCAGGAGAGAATGAGG + Intronic
1101696479 12:107132149-107132171 ATTCTAAGAAGGGTACAATGTGG - Intergenic
1102470807 12:113158889-113158911 GCTCCAAGAAGGGCAAGATGCGG - Exonic
1102713778 12:114952426-114952448 GTTCTAAGGAGGGCACATAGAGG - Intergenic
1103589371 12:121980361-121980383 ATTCTGAGCAAGGCAAAAAGTGG + Intronic
1103721064 12:122975725-122975747 ATTTTAAGCAGGGGAAACTGAGG + Intronic
1106680743 13:32004385-32004407 GTTCTAAGCAGCGAAAAAATTGG - Intergenic
1107149834 13:37098402-37098424 GTTTTGAGCAAGACAAAATGAGG - Intergenic
1111868928 13:93805917-93805939 GGACTAAGAAGGGCTAAATGAGG - Intronic
1112248248 13:97754125-97754147 GGTCTAAGCAAGGCACAAGGGGG - Intergenic
1116008473 14:39323198-39323220 GTTCTAAGTGAAGCAAAATGAGG - Intronic
1117941316 14:60968922-60968944 GTTTTAAGCAGTGGAAAATGAGG + Exonic
1121403387 14:93702708-93702730 TTTCTAACCTGGGCAAACTGGGG - Intronic
1122425108 14:101601273-101601295 GCTCTAGGCAGGGCACCATGCGG - Intergenic
1123133802 14:106009493-106009515 TATCTAAGCATGGAAAAATGCGG + Intergenic
1124954672 15:34352363-34352385 GTTGTAGGCAGGGGCAAATGAGG + Intronic
1125785071 15:42309278-42309300 GTGCTTAGCAGGGGAAGATGGGG - Intronic
1126404949 15:48314115-48314137 GCCCTGAGCAGGGCAGAATGCGG - Intergenic
1126957530 15:53950796-53950818 TCTCTAAGCAATGCAAAATGTGG - Intergenic
1127474907 15:59324026-59324048 GATCTAATCTGGGCAAAGTGAGG + Intronic
1129196387 15:73969725-73969747 GTTCTAAGCAGAGGAACATGAGG - Intergenic
1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG + Intronic
1132410851 15:101577304-101577326 GTCTTTAGCAGGACAAAATGCGG - Intergenic
1137810427 16:51347287-51347309 GTTGGAAGGAAGGCAAAATGAGG - Intergenic
1145010144 17:19363281-19363303 GTTCGAAGCTGGGGAAACTGAGG + Intronic
1147355471 17:39892627-39892649 GAACTAAGCAGGGAAAAAAGGGG - Intergenic
1147397770 17:40158128-40158150 ATGCTGAGCAGGGAAAAATGAGG + Intronic
1147884787 17:43677197-43677219 GTTCTAAGAGGAACAAAATGAGG - Intergenic
1148697357 17:49568561-49568583 GTTCTCAGCAGTCTAAAATGTGG + Intergenic
1149300746 17:55302975-55302997 GTTGTTAGGAGGGCAGAATGAGG + Intronic
1152320077 17:79603809-79603831 CTTCTCAGCAGGGTAAACTGAGG + Intergenic
1156712882 18:39967816-39967838 GCTATAAGGAGGCCAAAATGGGG - Intergenic
1157440029 18:47703587-47703609 GTTCTGAGGAGGACAGAATGAGG + Intergenic
1157628333 18:49070914-49070936 TTTCAAATCAGGGCACAATGGGG - Intronic
1157721223 18:49926078-49926100 TTTCTAAGCAGGGACAGATGTGG + Intronic
1158344728 18:56504704-56504726 GGTCTAAGCAAGACAAAAAGAGG - Intergenic
1160796076 19:946032-946054 TTTCTCAGCAGGGAAAAATGAGG + Intronic
1166184232 19:41128969-41128991 GATGGAAGCAGGGCAAAGTGAGG + Intergenic
1167377773 19:49120573-49120595 GTTCTAAGCAGAGCAAACGCTGG - Intronic
1168122883 19:54263851-54263873 GCTATGAGCAGGGCAAAGTGTGG - Intronic
928393312 2:30925780-30925802 GTTCTAAGCAGGGCAAGAGGTGG + Intronic
929965121 2:46528935-46528957 GTTCTAGGAAGGGCAGAATGAGG - Intronic
933285905 2:80384521-80384543 GTTCTTAGCAGGCCTTAATGAGG + Intronic
933845338 2:86321916-86321938 ATCCTAACCAGGGTAAAATGGGG + Intronic
934724340 2:96605705-96605727 CCTCTAAGAAGGGCAAAGTGGGG - Intronic
936950412 2:117972467-117972489 GTCCTAGGCAGGGAAAAGTGTGG + Intronic
941733330 2:168944458-168944480 GTTAGAAGCAGTGGAAAATGTGG + Intronic
943011764 2:182458738-182458760 GTTCTTAACAAAGCAAAATGTGG + Intronic
944929551 2:204502068-204502090 GCTCTGACCAGGACAAAATGGGG + Intergenic
945178898 2:207071264-207071286 GTTCCAAGCAGGGGAAAACGAGG + Intergenic
945815618 2:214601902-214601924 TCTCTCACCAGGGCAAAATGAGG + Intergenic
946245048 2:218382675-218382697 GCTCTAAGAAGGGCAAGCTGAGG - Intronic
946886639 2:224228377-224228399 GTTCTAGGAAAGGTAAAATGGGG - Intergenic
1168825361 20:809449-809471 TTTCTAATCAGGAAAAAATGTGG - Intergenic
1170439520 20:16364801-16364823 GATCTAAGAAGGCCACAATGAGG - Intronic
1170797056 20:19557096-19557118 GCACTCAGCAGGGCAAACTGTGG + Intronic
1170998711 20:21391939-21391961 TTTCTAAGCATAGCAAAATTCGG - Intergenic
1171344305 20:24453835-24453857 GTTCTCAGAAGGGCAAAGTCAGG + Intergenic
1171997853 20:31746661-31746683 ATTCTAAGCAGGGTGAAATAGGG - Intronic
1173379265 20:42523962-42523984 ATTCTAACCTGGGCAAAATAGGG + Intronic
1174501641 20:50989302-50989324 GTACTGAGCAGGGCACAAGGTGG + Intergenic
1177612264 21:23466857-23466879 ATTCTAAGCAGCAGAAAATGGGG + Intergenic
1178984326 21:37290028-37290050 GTCCTAACCAGGACAAAATCTGG + Intergenic
1179192917 21:39138532-39138554 GTTCACAGCATGGGAAAATGTGG + Intergenic
1181981468 22:26769728-26769750 GTTGTTAGGAGGACAAAATGAGG + Intergenic
1182097892 22:27638288-27638310 GTTCTCAGCAGAGGAAACTGAGG - Intergenic
1182689062 22:32143745-32143767 GGTCAAAGCAGGGGAAAATCAGG - Intergenic
949495659 3:4629269-4629291 GTTCTCAACAGGACAAACTGAGG - Intronic
952183667 3:30945395-30945417 CTGCTGAGGAGGGCAAAATGTGG - Intergenic
953628871 3:44594177-44594199 GTTCCAAGCAGGAGAAAATGAGG + Exonic
955042988 3:55334851-55334873 GTTCTAAAAAGGGCTTAATGAGG + Intergenic
955400898 3:58590899-58590921 GTTCCAAGGAGGGCAGAATCAGG - Intronic
955419745 3:58724390-58724412 GCTCTAAGCATGGGAACATGAGG - Intronic
957368053 3:79252348-79252370 CTTCTAAGAAGGGGAAAATTTGG + Intronic
957415763 3:79901410-79901432 GTGCTAGGCAGTGCAAAATGAGG - Intergenic
957900487 3:86482588-86482610 GTTCTAAGGAGGGATCAATGTGG - Intergenic
962713165 3:138104126-138104148 GGCCTAAGCGGGGCAAAGTGAGG + Intronic
963520582 3:146356639-146356661 GTTCTAGGACGGGTAAAATGGGG - Intergenic
963765641 3:149333377-149333399 GTTCTAAGCAGGGCAAAATGGGG - Exonic
968590628 4:1457713-1457735 CTGCTAAGCAGGGCATATTGTGG - Intergenic
969049897 4:4365345-4365367 CATCTAAGCAGGGCTAGATGGGG - Intronic
970512288 4:16793303-16793325 CCTCTAACCAGGGCAGAATGAGG + Intronic
970979959 4:22084728-22084750 GTTCTAACCATGGCATAAAGGGG - Intergenic
972606877 4:40621856-40621878 GTGCAAGGCAGGGCCAAATGTGG - Intronic
974081280 4:57215907-57215929 GGCCTAAGCAGGGCCAAAGGAGG - Intergenic
974821295 4:67069685-67069707 GTTCTAAGTACGGAAAACTGAGG - Intergenic
979338755 4:119494425-119494447 TTACAAAGCATGGCAAAATGAGG + Exonic
979592920 4:122501252-122501274 GTGCTCAGCAGGGGAAAATATGG - Intergenic
980441783 4:132857454-132857476 GTTCTTACCAGGACAAAAGGTGG - Intergenic
984685933 4:182668111-182668133 GTTCCATTAAGGGCAAAATGTGG - Intronic
986626615 5:9728859-9728881 GATCTCAGCAGGGAAAACTGAGG + Intergenic
986689222 5:10300155-10300177 CTTCTAAGGAGGGGAAAACGTGG + Intronic
986888463 5:12270069-12270091 GTTCTGAGCAGGTCCTAATGTGG - Intergenic
986914475 5:12600874-12600896 GTTCTAAGCACAGCAGGATGCGG - Intergenic
988511321 5:31867066-31867088 GGTGTAACCAGAGCAAAATGAGG - Intronic
990203369 5:53402792-53402814 GTGGTAGGCAGGGGAAAATGTGG - Intergenic
990603664 5:57385887-57385909 TTTCTAAGCTCTGCAAAATGTGG + Intergenic
992017085 5:72586467-72586489 GCTCTATGCAGGGCACACTGGGG - Intergenic
997813597 5:136995481-136995503 GCTCTAAGCAGGAGAGAATGTGG + Intronic
998567995 5:143233108-143233130 CTGCTGAGAAGGGCAAAATGAGG - Intergenic
999473100 5:151873764-151873786 GTTCCGAGCAGAGCAAAGTGGGG - Intronic
1001011132 5:168099478-168099500 GCTCTTAGCAGGGCACAATAAGG + Intronic
1001454919 5:171853111-171853133 GTTCTAGACAGGGCTGAATGGGG + Intergenic
1001649430 5:173304923-173304945 GTTCTCTGCAGGGCCAAATCAGG - Intergenic
1002047517 5:176550219-176550241 CTTCTCAGCAGGGGAAACTGAGG + Intronic
1004570340 6:16838785-16838807 GTCGAATGCAGGGCAAAATGTGG + Intergenic
1008480466 6:51980634-51980656 TTTCTTACAAGGGCAAAATGTGG + Intronic
1012226526 6:96710040-96710062 GTGCTAAGCAGACCAAAATTGGG + Intergenic
1012501106 6:99889037-99889059 GCACAAAGCAGGGCAAAAAGAGG - Intergenic
1013176853 6:107685211-107685233 GTTCTCAGCATAGCCAAATGAGG + Intergenic
1015094544 6:129399230-129399252 GTTCTAAGAAGAACAAAATAAGG + Intronic
1016382083 6:143494646-143494668 CTTCTAAGCAGGACAAGATGTGG + Intergenic
1021292569 7:18864439-18864461 GATCTGACCAGGGGAAAATGGGG + Intronic
1021581208 7:22155774-22155796 TTTTTAAGCAAGGCAAAATCTGG + Intronic
1023224119 7:37951292-37951314 GTTCTAGGAAGGCCAAAGTGCGG - Exonic
1023375784 7:39553471-39553493 GTTCTAAACAGGGATAAATGAGG - Intergenic
1023503252 7:40873184-40873206 GTTCTAACAAGGTTAAAATGAGG + Intergenic
1028347671 7:89802913-89802935 ATTCTAAGTAGGGTAAGATGAGG + Intergenic
1033307688 7:140237224-140237246 GTTCTGAGCTGGGCAAGACGAGG + Intergenic
1033474562 7:141678835-141678857 GATCTGAGCAAGGTAAAATGTGG + Intronic
1034562002 7:151886420-151886442 GTGGTGAGCAGGGAAAAATGTGG + Intergenic
1035416679 7:158695170-158695192 GTTCTATTCAGGGCAAACTCTGG + Intronic
1035603307 8:911867-911889 GATCTAAGCAGGGAAAACTTTGG + Intergenic
1036082817 8:5575986-5576008 GTTATAAGCTATGCAAAATGTGG + Intergenic
1036087202 8:5625350-5625372 GTGCTGAGCAGAGAAAAATGCGG - Intergenic
1037088986 8:14889941-14889963 GTTGAAAGCAGGCCTAAATGAGG + Intronic
1039804598 8:40987419-40987441 GTCCTAAGCCAGGCAAAGTGTGG - Intergenic
1043778014 8:84294915-84294937 ATTCAAAGCAGGGCAAAAATTGG + Intronic
1045853564 8:106734206-106734228 GTTTTAATTTGGGCAAAATGGGG + Intronic
1047463651 8:125091904-125091926 GGTCTAGGCAGGGGAAATTGGGG + Exonic
1048335769 8:133501112-133501134 TTTCTAAGCAAGGCCAGATGTGG + Intronic
1050244245 9:3671369-3671391 GTTCTAAGCAGGGCCCATTAGGG + Intergenic
1050461857 9:5884278-5884300 GTTTTAAGCAGGGAAAAAAATGG - Intronic
1052107961 9:24543843-24543865 GTAGTAAACAGGGCAAACTGAGG - Intronic
1055353483 9:75413483-75413505 GAGAGAAGCAGGGCAAAATGTGG - Intergenic
1058457899 9:105155201-105155223 CTGCTAATCAGGGGAAAATGAGG + Intergenic
1059263314 9:113000785-113000807 GCTCTAAGCAGGGGAATATATGG + Intergenic
1059409237 9:114121825-114121847 GTTCAAAGAAGGGAAAATTGAGG - Intergenic
1059715283 9:116907537-116907559 GTGTTAAGCAAGGCTAAATGGGG + Intronic
1061589479 9:131589351-131589373 GTGCTCAGCAGGGCAAGTTGGGG - Intronic
1186545841 X:10448662-10448684 GAGAGAAGCAGGGCAAAATGTGG + Exonic
1186881153 X:13867570-13867592 TTGATAAGCAGGGCAAAATAGGG - Intronic
1188463241 X:30451725-30451747 GTTCTAGGAAAGGTAAAATGGGG + Intergenic
1190550598 X:51575987-51576009 ATGCCAAGCAGGGCCAAATGTGG - Intergenic
1198582758 X:138084637-138084659 GTTCTAAGCACAGAAAAAAGTGG - Intergenic
1199065896 X:143417921-143417943 GTGCTATGCTGGGCTAAATGGGG - Intergenic