ID: 963767117

View in Genome Browser
Species Human (GRCh38)
Location 3:149348933-149348955
Sequence CTGTTTATACTGATGCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963767113_963767117 14 Left 963767113 3:149348896-149348918 CCACTAAGATGTAGATTAATTTA No data
Right 963767117 3:149348933-149348955 CTGTTTATACTGATGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963767117 Original CRISPR CTGTTTATACTGATGCATCT TGG Intergenic
No off target data available for this crispr